ID: 957430811

View in Genome Browser
Species Human (GRCh38)
Location 3:80103944-80103966
Sequence GCTGCAGCTGAGAAGGGTCC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
957430811_957430815 11 Left 957430811 3:80103944-80103966 CCTGGACCCTTCTCAGCTGCAGC No data
Right 957430815 3:80103978-80104000 GTTACTTGAAAGCCATATTCAGG No data
957430811_957430817 29 Left 957430811 3:80103944-80103966 CCTGGACCCTTCTCAGCTGCAGC No data
Right 957430817 3:80103996-80104018 TCAGGTTTACAGCTTACGTGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
957430811 Original CRISPR GCTGCAGCTGAGAAGGGTCC AGG (reversed) Intergenic
No off target data available for this crispr