ID: 957436136

View in Genome Browser
Species Human (GRCh38)
Location 3:80178666-80178688
Sequence GTGTAAAAGTACAATTATAT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
957436136_957436142 11 Left 957436136 3:80178666-80178688 CCAATATAATTGTACTTTTACAC No data
Right 957436142 3:80178700-80178722 ATGTATCCTTCATAAGATCAGGG No data
957436136_957436141 10 Left 957436136 3:80178666-80178688 CCAATATAATTGTACTTTTACAC No data
Right 957436141 3:80178699-80178721 GATGTATCCTTCATAAGATCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
957436136 Original CRISPR GTGTAAAAGTACAATTATAT TGG (reversed) Intergenic
No off target data available for this crispr