ID: 957436199

View in Genome Browser
Species Human (GRCh38)
Location 3:80180095-80180117
Sequence CTCTTAAGTGGTTAGTAGGA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
957436196_957436199 -2 Left 957436196 3:80180074-80180096 CCACAGGTATAGCTCTTTACACT No data
Right 957436199 3:80180095-80180117 CTCTTAAGTGGTTAGTAGGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
957436199 Original CRISPR CTCTTAAGTGGTTAGTAGGA AGG Intergenic
No off target data available for this crispr