ID: 957443988

View in Genome Browser
Species Human (GRCh38)
Location 3:80291544-80291566
Sequence GGGCAGGATAATGCAAGGGG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
957443980_957443988 0 Left 957443980 3:80291521-80291543 CCTTTCAATTCATGTCATATCCA No data
Right 957443988 3:80291544-80291566 GGGCAGGATAATGCAAGGGGTGG No data
957443979_957443988 12 Left 957443979 3:80291509-80291531 CCAAAATAATCTCCTTTCAATTC No data
Right 957443988 3:80291544-80291566 GGGCAGGATAATGCAAGGGGTGG No data
957443978_957443988 13 Left 957443978 3:80291508-80291530 CCCAAAATAATCTCCTTTCAATT No data
Right 957443988 3:80291544-80291566 GGGCAGGATAATGCAAGGGGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
957443988 Original CRISPR GGGCAGGATAATGCAAGGGG TGG Intergenic
No off target data available for this crispr