ID: 957449794

View in Genome Browser
Species Human (GRCh38)
Location 3:80364991-80365013
Sequence ATTTGAAGTATGGCAGTACT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
957449794_957449797 10 Left 957449794 3:80364991-80365013 CCAAGTACTGCCATACTTCAAAT No data
Right 957449797 3:80365024-80365046 GGATTTATTTTTCCCCTGACAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
957449794 Original CRISPR ATTTGAAGTATGGCAGTACT TGG (reversed) Intergenic
No off target data available for this crispr