ID: 957450361

View in Genome Browser
Species Human (GRCh38)
Location 3:80373532-80373554
Sequence GTTAACAATATGAAGAATGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
957450361_957450363 10 Left 957450361 3:80373532-80373554 CCTTCATTCTTCATATTGTTAAC No data
Right 957450363 3:80373565-80373587 TCATTTTCTTTTTTCTGAGAGGG No data
957450361_957450362 9 Left 957450361 3:80373532-80373554 CCTTCATTCTTCATATTGTTAAC No data
Right 957450362 3:80373564-80373586 CTCATTTTCTTTTTTCTGAGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
957450361 Original CRISPR GTTAACAATATGAAGAATGA AGG (reversed) Intergenic
No off target data available for this crispr