ID: 957450362

View in Genome Browser
Species Human (GRCh38)
Location 3:80373564-80373586
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
957450361_957450362 9 Left 957450361 3:80373532-80373554 CCTTCATTCTTCATATTGTTAAC No data
Right 957450362 3:80373564-80373586 CTCATTTTCTTTTTTCTGAGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
No off target data available for this crispr