ID: 957450585

View in Genome Browser
Species Human (GRCh38)
Location 3:80377074-80377096
Sequence GAACCCAGGATGCCAGAAGG CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
957450585_957450589 12 Left 957450585 3:80377074-80377096 CCGCCTTCTGGCATCCTGGGTTC No data
Right 957450589 3:80377109-80377131 GCCTCAGCCTCCCAAGTAGCTGG 0: 81212
1: 190903
2: 234468
3: 228974
4: 272812
957450585_957450591 13 Left 957450585 3:80377074-80377096 CCGCCTTCTGGCATCCTGGGTTC No data
Right 957450591 3:80377110-80377132 CCTCAGCCTCCCAAGTAGCTGGG 0: 92836
1: 203589
2: 246027
3: 262461
4: 302975
957450585_957450593 21 Left 957450585 3:80377074-80377096 CCGCCTTCTGGCATCCTGGGTTC No data
Right 957450593 3:80377118-80377140 TCCCAAGTAGCTGGGATTACAGG 0: 48553
1: 142115
2: 242012
3: 520212
4: 384467

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
957450585 Original CRISPR GAACCCAGGATGCCAGAAGG CGG (reversed) Intergenic
No off target data available for this crispr