ID: 957450767

View in Genome Browser
Species Human (GRCh38)
Location 3:80379033-80379055
Sequence CTAGTGGTTTGCAGCCTAAG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
957450767_957450772 -4 Left 957450767 3:80379033-80379055 CCCCTTAGGCTGCAAACCACTAG No data
Right 957450772 3:80379052-80379074 CTAGTAGGTAATGCGAGTGTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
957450767 Original CRISPR CTAGTGGTTTGCAGCCTAAG GGG (reversed) Intergenic
No off target data available for this crispr