ID: 957450769

View in Genome Browser
Species Human (GRCh38)
Location 3:80379035-80379057
Sequence TACTAGTGGTTTGCAGCCTA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
957450769_957450772 -6 Left 957450769 3:80379035-80379057 CCTTAGGCTGCAAACCACTAGTA No data
Right 957450772 3:80379052-80379074 CTAGTAGGTAATGCGAGTGTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
957450769 Original CRISPR TACTAGTGGTTTGCAGCCTA AGG (reversed) Intergenic