ID: 957450772

View in Genome Browser
Species Human (GRCh38)
Location 3:80379052-80379074
Sequence CTAGTAGGTAATGCGAGTGT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
957450767_957450772 -4 Left 957450767 3:80379033-80379055 CCCCTTAGGCTGCAAACCACTAG No data
Right 957450772 3:80379052-80379074 CTAGTAGGTAATGCGAGTGTTGG No data
957450768_957450772 -5 Left 957450768 3:80379034-80379056 CCCTTAGGCTGCAAACCACTAGT No data
Right 957450772 3:80379052-80379074 CTAGTAGGTAATGCGAGTGTTGG No data
957450769_957450772 -6 Left 957450769 3:80379035-80379057 CCTTAGGCTGCAAACCACTAGTA No data
Right 957450772 3:80379052-80379074 CTAGTAGGTAATGCGAGTGTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
957450772 Original CRISPR CTAGTAGGTAATGCGAGTGT TGG Intergenic
No off target data available for this crispr