ID: 957451742

View in Genome Browser
Species Human (GRCh38)
Location 3:80389125-80389147
Sequence GAGGTGAGTTTTTATTAAAG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
957451742_957451749 24 Left 957451742 3:80389125-80389147 CCTCTTTAATAAAAACTCACCTC No data
Right 957451749 3:80389172-80389194 GCTGGAGTCATTCACTGCAAGGG 0: 142
1: 113
2: 46
3: 37
4: 172
957451742_957451745 -1 Left 957451742 3:80389125-80389147 CCTCTTTAATAAAAACTCACCTC No data
Right 957451745 3:80389147-80389169 CAAGGCTGCTTTACTTCCAAAGG No data
957451742_957451748 23 Left 957451742 3:80389125-80389147 CCTCTTTAATAAAAACTCACCTC No data
Right 957451748 3:80389171-80389193 AGCTGGAGTCATTCACTGCAAGG 0: 88
1: 76
2: 38
3: 18
4: 162
957451742_957451746 6 Left 957451742 3:80389125-80389147 CCTCTTTAATAAAAACTCACCTC No data
Right 957451746 3:80389154-80389176 GCTTTACTTCCAAAGGAAGCTGG 0: 132
1: 119
2: 31
3: 22
4: 182

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
957451742 Original CRISPR GAGGTGAGTTTTTATTAAAG AGG (reversed) Intergenic
No off target data available for this crispr