ID: 957457893

View in Genome Browser
Species Human (GRCh38)
Location 3:80476317-80476339
Sequence CTCTTCACTGTTTCACAGTA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
957457892_957457893 -7 Left 957457892 3:80476301-80476323 CCAAATATGTAGAATTCTCTTCA No data
Right 957457893 3:80476317-80476339 CTCTTCACTGTTTCACAGTATGG No data
957457891_957457893 -6 Left 957457891 3:80476300-80476322 CCCAAATATGTAGAATTCTCTTC No data
Right 957457893 3:80476317-80476339 CTCTTCACTGTTTCACAGTATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
957457893 Original CRISPR CTCTTCACTGTTTCACAGTA TGG Intergenic
No off target data available for this crispr