ID: 957471431

View in Genome Browser
Species Human (GRCh38)
Location 3:80662587-80662609
Sequence AAAATCTTGCTGTCATCTAG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
957471430_957471431 3 Left 957471430 3:80662561-80662583 CCTAGATAGAATGCATTATATAT No data
Right 957471431 3:80662587-80662609 AAAATCTTGCTGTCATCTAGAGG No data
957471429_957471431 10 Left 957471429 3:80662554-80662576 CCACAGACCTAGATAGAATGCAT No data
Right 957471431 3:80662587-80662609 AAAATCTTGCTGTCATCTAGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
957471431 Original CRISPR AAAATCTTGCTGTCATCTAG AGG Intergenic
No off target data available for this crispr