ID: 957474874

View in Genome Browser
Species Human (GRCh38)
Location 3:80709927-80709949
Sequence TTATCTACAAGCCCCTGACT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 11 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
957474874_957474891 26 Left 957474874 3:80709927-80709949 CCCAGTCAGGGGCTTGTAGATAA No data
Right 957474891 3:80709976-80709998 CCAGGGGAAGGGGTGGCTGTGGG No data
957474874_957474882 10 Left 957474874 3:80709927-80709949 CCCAGTCAGGGGCTTGTAGATAA No data
Right 957474882 3:80709960-80709982 TCCCTGGGACACAGCACCAGGGG No data
957474874_957474876 -6 Left 957474874 3:80709927-80709949 CCCAGTCAGGGGCTTGTAGATAA No data
Right 957474876 3:80709944-80709966 AGATAAAACTCCCATCTCCCTGG No data
957474874_957474877 -5 Left 957474874 3:80709927-80709949 CCCAGTCAGGGGCTTGTAGATAA No data
Right 957474877 3:80709945-80709967 GATAAAACTCCCATCTCCCTGGG No data
957474874_957474886 15 Left 957474874 3:80709927-80709949 CCCAGTCAGGGGCTTGTAGATAA No data
Right 957474886 3:80709965-80709987 GGGACACAGCACCAGGGGAAGGG No data
957474874_957474885 14 Left 957474874 3:80709927-80709949 CCCAGTCAGGGGCTTGTAGATAA No data
Right 957474885 3:80709964-80709986 TGGGACACAGCACCAGGGGAAGG No data
957474874_957474888 19 Left 957474874 3:80709927-80709949 CCCAGTCAGGGGCTTGTAGATAA No data
Right 957474888 3:80709969-80709991 CACAGCACCAGGGGAAGGGGTGG No data
957474874_957474889 25 Left 957474874 3:80709927-80709949 CCCAGTCAGGGGCTTGTAGATAA No data
Right 957474889 3:80709975-80709997 ACCAGGGGAAGGGGTGGCTGTGG No data
957474874_957474881 9 Left 957474874 3:80709927-80709949 CCCAGTCAGGGGCTTGTAGATAA No data
Right 957474881 3:80709959-80709981 CTCCCTGGGACACAGCACCAGGG No data
957474874_957474880 8 Left 957474874 3:80709927-80709949 CCCAGTCAGGGGCTTGTAGATAA No data
Right 957474880 3:80709958-80709980 TCTCCCTGGGACACAGCACCAGG No data
957474874_957474887 16 Left 957474874 3:80709927-80709949 CCCAGTCAGGGGCTTGTAGATAA No data
Right 957474887 3:80709966-80709988 GGACACAGCACCAGGGGAAGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
957474874 Original CRISPR TTATCTACAAGCCCCTGACT GGG (reversed) Intergenic