ID: 957480612

View in Genome Browser
Species Human (GRCh38)
Location 3:80788735-80788757
Sequence GGCCTAAATAGAACAAAAGG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
957480605_957480612 15 Left 957480605 3:80788697-80788719 CCTCCCGGATGTAAGTGGGTATC No data
Right 957480612 3:80788735-80788757 GGCCTAAATAGAACAAAAGGTGG No data
957480607_957480612 11 Left 957480607 3:80788701-80788723 CCGGATGTAAGTGGGTATCATGC No data
Right 957480612 3:80788735-80788757 GGCCTAAATAGAACAAAAGGTGG No data
957480606_957480612 12 Left 957480606 3:80788700-80788722 CCCGGATGTAAGTGGGTATCATG No data
Right 957480612 3:80788735-80788757 GGCCTAAATAGAACAAAAGGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
957480612 Original CRISPR GGCCTAAATAGAACAAAAGG TGG Intergenic
No off target data available for this crispr