ID: 957484356

View in Genome Browser
Species Human (GRCh38)
Location 3:80838679-80838701
Sequence ACGAATGTACTAGTGTGTTG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
957484356_957484359 -3 Left 957484356 3:80838679-80838701 CCCCAACACACTAGTACATTCGT No data
Right 957484359 3:80838699-80838721 CGTATTTTTTTGCACTGTCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
957484356 Original CRISPR ACGAATGTACTAGTGTGTTG GGG (reversed) Intergenic
No off target data available for this crispr