ID: 957485049

View in Genome Browser
Species Human (GRCh38)
Location 3:80850116-80850138
Sequence CTTGACATGGGGCAGATTAT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
957485049_957485057 -5 Left 957485049 3:80850116-80850138 CCCATAATCTGCCCCATGTCAAG No data
Right 957485057 3:80850134-80850156 TCAAGGAAGAGACCAGGTGGAGG No data
957485049_957485060 12 Left 957485049 3:80850116-80850138 CCCATAATCTGCCCCATGTCAAG No data
Right 957485060 3:80850151-80850173 TGGAGGTAATTGAAATATTTGGG No data
957485049_957485059 11 Left 957485049 3:80850116-80850138 CCCATAATCTGCCCCATGTCAAG No data
Right 957485059 3:80850150-80850172 GTGGAGGTAATTGAAATATTTGG No data
957485049_957485061 15 Left 957485049 3:80850116-80850138 CCCATAATCTGCCCCATGTCAAG No data
Right 957485061 3:80850154-80850176 AGGTAATTGAAATATTTGGGTGG No data
957485049_957485056 -8 Left 957485049 3:80850116-80850138 CCCATAATCTGCCCCATGTCAAG No data
Right 957485056 3:80850131-80850153 ATGTCAAGGAAGAGACCAGGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
957485049 Original CRISPR CTTGACATGGGGCAGATTAT GGG (reversed) Intergenic
No off target data available for this crispr