ID: 957485589

View in Genome Browser
Species Human (GRCh38)
Location 3:80858413-80858435
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
957485584_957485589 14 Left 957485584 3:80858376-80858398 CCACATGGCATGGAGACATAATC No data
Right 957485589 3:80858413-80858435 AGGGAGAGCACAGTGATTGAGGG No data
957485581_957485589 26 Left 957485581 3:80858364-80858386 CCCTCTTAGTGGCCACATGGCAT No data
Right 957485589 3:80858413-80858435 AGGGAGAGCACAGTGATTGAGGG No data
957485580_957485589 27 Left 957485580 3:80858363-80858385 CCCCTCTTAGTGGCCACATGGCA No data
Right 957485589 3:80858413-80858435 AGGGAGAGCACAGTGATTGAGGG No data
957485582_957485589 25 Left 957485582 3:80858365-80858387 CCTCTTAGTGGCCACATGGCATG No data
Right 957485589 3:80858413-80858435 AGGGAGAGCACAGTGATTGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type