ID: 957487864

View in Genome Browser
Species Human (GRCh38)
Location 3:80886321-80886343
Sequence TCTATCATGAAGGTCATGAA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
957487857_957487864 30 Left 957487857 3:80886268-80886290 CCTGACATATATCTTTGCTGGTG No data
Right 957487864 3:80886321-80886343 TCTATCATGAAGGTCATGAAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
957487864 Original CRISPR TCTATCATGAAGGTCATGAA GGG Intergenic
No off target data available for this crispr