ID: 957493156

View in Genome Browser
Species Human (GRCh38)
Location 3:80955809-80955831
Sequence AGAATCTACGAAGACATAAA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
957493156_957493158 16 Left 957493156 3:80955809-80955831 CCATTTATGTCTTCGTAGATTCT No data
Right 957493158 3:80955848-80955870 AATCTGGTAAATCAAAACACAGG No data
957493156_957493157 0 Left 957493156 3:80955809-80955831 CCATTTATGTCTTCGTAGATTCT No data
Right 957493157 3:80955832-80955854 AAGAAAGATAGTTCATAATCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
957493156 Original CRISPR AGAATCTACGAAGACATAAA TGG (reversed) Intergenic
No off target data available for this crispr