ID: 957498325

View in Genome Browser
Species Human (GRCh38)
Location 3:81020150-81020172
Sequence GAAATCAGCTTGGCATAAAC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
957498325_957498331 28 Left 957498325 3:81020150-81020172 CCTGTTTATGCCAAGCTGATTTC No data
Right 957498331 3:81020201-81020223 CCACAGAAATATCCCTGAATTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
957498325 Original CRISPR GAAATCAGCTTGGCATAAAC AGG (reversed) Intergenic
No off target data available for this crispr