ID: 957503611

View in Genome Browser
Species Human (GRCh38)
Location 3:81091043-81091065
Sequence TAACCAGAAGGTCCCATCTG GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
957503605_957503611 -4 Left 957503605 3:81091024-81091046 CCCTGAGCTTGTTTTCCTATAAC No data
Right 957503611 3:81091043-81091065 TAACCAGAAGGTCCCATCTGGGG No data
957503606_957503611 -5 Left 957503606 3:81091025-81091047 CCTGAGCTTGTTTTCCTATAACC No data
Right 957503611 3:81091043-81091065 TAACCAGAAGGTCCCATCTGGGG No data
957503604_957503611 19 Left 957503604 3:81091001-81091023 CCATAATGTAGAATTAGTGGGAG No data
Right 957503611 3:81091043-81091065 TAACCAGAAGGTCCCATCTGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
957503611 Original CRISPR TAACCAGAAGGTCCCATCTG GGG Intergenic
No off target data available for this crispr