ID: 957505614

View in Genome Browser
Species Human (GRCh38)
Location 3:81116576-81116598
Sequence CACAGAGAAATCCCTAATAG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
957505614_957505617 -8 Left 957505614 3:81116576-81116598 CCTCTATTAGGGATTTCTCTGTG No data
Right 957505617 3:81116591-81116613 TCTCTGTGCCATTTGGGCTATGG No data
957505614_957505618 -7 Left 957505614 3:81116576-81116598 CCTCTATTAGGGATTTCTCTGTG No data
Right 957505618 3:81116592-81116614 CTCTGTGCCATTTGGGCTATGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
957505614 Original CRISPR CACAGAGAAATCCCTAATAG AGG (reversed) Intergenic
No off target data available for this crispr