ID: 957507349

View in Genome Browser
Species Human (GRCh38)
Location 3:81139647-81139669
Sequence GGTCTAATTCCACAACATAT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
957507345_957507349 8 Left 957507345 3:81139616-81139638 CCTATTTAGTTGTTTTCATGGCT No data
Right 957507349 3:81139647-81139669 GGTCTAATTCCACAACATATGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
957507349 Original CRISPR GGTCTAATTCCACAACATAT GGG Intergenic