ID: 957508064

View in Genome Browser
Species Human (GRCh38)
Location 3:81151463-81151485
Sequence CATGGGATGCAGAAATAGGA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
957508059_957508064 6 Left 957508059 3:81151434-81151456 CCACCACACTGCACTTAGACAGC No data
Right 957508064 3:81151463-81151485 CATGGGATGCAGAAATAGGATGG No data
957508060_957508064 3 Left 957508060 3:81151437-81151459 CCACACTGCACTTAGACAGCTGC No data
Right 957508064 3:81151463-81151485 CATGGGATGCAGAAATAGGATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
957508064 Original CRISPR CATGGGATGCAGAAATAGGA TGG Intergenic
No off target data available for this crispr