ID: 957509742

View in Genome Browser
Species Human (GRCh38)
Location 3:81171887-81171909
Sequence GCATTTAACTTGATAGATCA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
957509742_957509745 29 Left 957509742 3:81171887-81171909 CCCTGATCTATCAAGTTAAATGC No data
Right 957509745 3:81171939-81171961 AAGTGCCCTAGCCTATAGCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
957509742 Original CRISPR GCATTTAACTTGATAGATCA GGG (reversed) Intergenic
No off target data available for this crispr