ID: 957509867

View in Genome Browser
Species Human (GRCh38)
Location 3:81173696-81173718
Sequence TTTTCTATACTGAATGTAGT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
957509867_957509868 -10 Left 957509867 3:81173696-81173718 CCAACTACATTCAGTATAGAAAA No data
Right 957509868 3:81173709-81173731 GTATAGAAAACGCCACCAACTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
957509867 Original CRISPR TTTTCTATACTGAATGTAGT TGG (reversed) Intergenic
No off target data available for this crispr