ID: 957509867 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | 3:81173696-81173718 |
| Sequence | TTTTCTATACTGAATGTAGT TGG (reversed) |
| Strand | - |
| Crispr in exon? | No |
| Crispr in intron? | No |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | No data | |||
| Summary | No data |
Found 1 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 957509867_957509868 | -10 | Left | 957509867 | 3:81173696-81173718 | CCAACTACATTCAGTATAGAAAA | No data | ||
| Right | 957509868 | 3:81173709-81173731 | GTATAGAAAACGCCACCAACTGG | No data |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 957509867 | Original CRISPR | TTTTCTATACTGAATGTAGT TGG (reversed) | Intergenic | ||
| No off target data available for this crispr | |||||