ID: 957514714

View in Genome Browser
Species Human (GRCh38)
Location 3:81235154-81235176
Sequence ATTCACATGTGGCAGAGAAG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
957514714_957514717 -8 Left 957514714 3:81235154-81235176 CCTCTTCTCTGCCACATGTGAAT No data
Right 957514717 3:81235169-81235191 ATGTGAATGTGGACTACTTCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
957514714 Original CRISPR ATTCACATGTGGCAGAGAAG AGG (reversed) Intergenic
No off target data available for this crispr