ID: 957515603

View in Genome Browser
Species Human (GRCh38)
Location 3:81247052-81247074
Sequence TCTACAAAGTGCATTACCTA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
957515601_957515603 -5 Left 957515601 3:81247034-81247056 CCTCACATTCCTGCTGTTTCTAC No data
Right 957515603 3:81247052-81247074 TCTACAAAGTGCATTACCTAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
957515603 Original CRISPR TCTACAAAGTGCATTACCTA AGG Intergenic
No off target data available for this crispr