ID: 957523037

View in Genome Browser
Species Human (GRCh38)
Location 3:81345564-81345586
Sequence CAGAATAAGGGGAAGGTGGA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
957523028_957523037 27 Left 957523028 3:81345514-81345536 CCGATAGAGTTCCATCTCTATCG No data
Right 957523037 3:81345564-81345586 CAGAATAAGGGGAAGGTGGATGG No data
957523029_957523037 16 Left 957523029 3:81345525-81345547 CCATCTCTATCGATCTTACTCTG No data
Right 957523037 3:81345564-81345586 CAGAATAAGGGGAAGGTGGATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
957523037 Original CRISPR CAGAATAAGGGGAAGGTGGA TGG Intergenic
No off target data available for this crispr