ID: 957527519

View in Genome Browser
Species Human (GRCh38)
Location 3:81396034-81396056
Sequence GTCACAGAAGAGTCTCCGTC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
957527515_957527519 8 Left 957527515 3:81396003-81396025 CCAGAAGCAGCCACAGGTCAGAT No data
Right 957527519 3:81396034-81396056 GTCACAGAAGAGTCTCCGTCTGG No data
957527513_957527519 21 Left 957527513 3:81395990-81396012 CCAGGGCACTGGGCCAGAAGCAG No data
Right 957527519 3:81396034-81396056 GTCACAGAAGAGTCTCCGTCTGG No data
957527516_957527519 -2 Left 957527516 3:81396013-81396035 CCACAGGTCAGATGACCGCCAGT No data
Right 957527519 3:81396034-81396056 GTCACAGAAGAGTCTCCGTCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
957527519 Original CRISPR GTCACAGAAGAGTCTCCGTC TGG Intergenic
No off target data available for this crispr