ID: 957528440

View in Genome Browser
Species Human (GRCh38)
Location 3:81408354-81408376
Sequence GCTGTCCAGGACATCATTAT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
957528440_957528443 9 Left 957528440 3:81408354-81408376 CCAATAATGATGTCCTGGACAGC No data
Right 957528443 3:81408386-81408408 TAATGCACTGAAGTCCAGCCAGG No data
957528440_957528444 10 Left 957528440 3:81408354-81408376 CCAATAATGATGTCCTGGACAGC No data
Right 957528444 3:81408387-81408409 AATGCACTGAAGTCCAGCCAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
957528440 Original CRISPR GCTGTCCAGGACATCATTAT TGG (reversed) Intergenic
No off target data available for this crispr