ID: 957528444

View in Genome Browser
Species Human (GRCh38)
Location 3:81408387-81408409
Sequence AATGCACTGAAGTCCAGCCA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
957528441_957528444 -3 Left 957528441 3:81408367-81408389 CCTGGACAGCAATCTGCCATAAT No data
Right 957528444 3:81408387-81408409 AATGCACTGAAGTCCAGCCAGGG No data
957528438_957528444 29 Left 957528438 3:81408335-81408357 CCAAGATAAGACAAGATTACCAA No data
Right 957528444 3:81408387-81408409 AATGCACTGAAGTCCAGCCAGGG No data
957528440_957528444 10 Left 957528440 3:81408354-81408376 CCAATAATGATGTCCTGGACAGC No data
Right 957528444 3:81408387-81408409 AATGCACTGAAGTCCAGCCAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
957528444 Original CRISPR AATGCACTGAAGTCCAGCCA GGG Intergenic
No off target data available for this crispr