ID: 957529578

View in Genome Browser
Species Human (GRCh38)
Location 3:81424104-81424126
Sequence CTGTAGATCTCAAGGCCAAA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
957529578_957529587 21 Left 957529578 3:81424104-81424126 CCATTTGGCCTTGAGATCTACAG No data
Right 957529587 3:81424148-81424170 GGGAAACAATGGCAGAGTAAGGG No data
957529578_957529584 10 Left 957529578 3:81424104-81424126 CCATTTGGCCTTGAGATCTACAG No data
Right 957529584 3:81424137-81424159 TGTGACCATTGGGGAAACAATGG No data
957529578_957529583 1 Left 957529578 3:81424104-81424126 CCATTTGGCCTTGAGATCTACAG No data
Right 957529583 3:81424128-81424150 CAGCTTTTATGTGACCATTGGGG No data
957529578_957529582 0 Left 957529578 3:81424104-81424126 CCATTTGGCCTTGAGATCTACAG No data
Right 957529582 3:81424127-81424149 GCAGCTTTTATGTGACCATTGGG No data
957529578_957529581 -1 Left 957529578 3:81424104-81424126 CCATTTGGCCTTGAGATCTACAG No data
Right 957529581 3:81424126-81424148 GGCAGCTTTTATGTGACCATTGG No data
957529578_957529586 20 Left 957529578 3:81424104-81424126 CCATTTGGCCTTGAGATCTACAG No data
Right 957529586 3:81424147-81424169 GGGGAAACAATGGCAGAGTAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
957529578 Original CRISPR CTGTAGATCTCAAGGCCAAA TGG (reversed) Intergenic
No off target data available for this crispr