ID: 957538098

View in Genome Browser
Species Human (GRCh38)
Location 3:81532020-81532042
Sequence AGGGAAAACACAGTGACTGT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 551
Summary {0: 1, 1: 1, 2: 25, 3: 102, 4: 422}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
957538098_957538105 18 Left 957538098 3:81532020-81532042 CCCACAGTCACTGTGTTTTCCCT 0: 1
1: 1
2: 25
3: 102
4: 422
Right 957538105 3:81532061-81532083 CTCTTCTTCCATGTGCCATGTGG 0: 1
1: 1
2: 2
3: 17
4: 228
957538098_957538108 30 Left 957538098 3:81532020-81532042 CCCACAGTCACTGTGTTTTCCCT 0: 1
1: 1
2: 25
3: 102
4: 422
Right 957538108 3:81532073-81532095 GTGCCATGTGGTGCTGCCAAGGG 0: 1
1: 1
2: 2
3: 8
4: 130
957538098_957538107 29 Left 957538098 3:81532020-81532042 CCCACAGTCACTGTGTTTTCCCT 0: 1
1: 1
2: 25
3: 102
4: 422
Right 957538107 3:81532072-81532094 TGTGCCATGTGGTGCTGCCAAGG 0: 2
1: 0
2: 2
3: 25
4: 249

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
957538098 Original CRISPR AGGGAAAACACAGTGACTGT GGG (reversed) Intronic
902172857 1:14627136-14627158 AGGGAAATCAGAGTGGCTGGGGG + Intronic
903182055 1:21609747-21609769 CGGGGAGACCCAGTGACTGTGGG + Intronic
903291531 1:22317386-22317408 AGGGCAGAAACAGTGATTGTGGG + Intergenic
905739816 1:40360692-40360714 AAGGAGAGCACAGTGATTGTGGG + Intronic
906097031 1:43230954-43230976 AGGGGATACACATTGAGTGTGGG - Intronic
906101626 1:43267587-43267609 GGGGAGAACACAGAGGCTGTGGG - Intronic
907011061 1:50963610-50963632 AGGGAAGAAACAGTGTCTTTGGG - Intronic
908093020 1:60706648-60706670 AGGGAAAGTGAAGTGACTGTGGG + Intergenic
908985234 1:70010000-70010022 GGGGAAAAATCAGTGACTGAGGG - Intronic
909848910 1:80434818-80434840 AGGGAGATCTCAGTGACTGGGGG - Intergenic
910470525 1:87547745-87547767 AGGGAGAGGACAGTGACTGTGGG - Intergenic
910724845 1:90327793-90327815 AGGGAGAATGCAGTGATTGTGGG + Intergenic
910801255 1:91149060-91149082 AGGGGGAGCACAGTGATTGTGGG - Intergenic
910959627 1:92747956-92747978 AGGGAAGATACAGTCACTGGAGG - Intronic
911668979 1:100587100-100587122 AGGGAAGAAGCAGAGACTGTTGG - Intergenic
911997933 1:104790645-104790667 AGGCAAAACACTGAGACAGTCGG + Intergenic
912633375 1:111268303-111268325 AGGAAGAACACAGTGATTGTAGG - Intergenic
912643821 1:111372275-111372297 AGGGAGAGCACAGTGATTGTGGG + Intergenic
912871407 1:113310480-113310502 AGGGAGAGCACAGGGATTGTGGG + Intergenic
914370337 1:147019268-147019290 ATGGAAAACTCAGTGAATATAGG - Intergenic
914484357 1:148094142-148094164 ATGGAAAACTCAGTGAATATAGG + Intergenic
914582608 1:149032348-149032370 ATGGAAAACTCAGTGAATATAGG + Exonic
915611422 1:156996441-156996463 AGGGAGGACACAGGGACTCTGGG + Intronic
915802190 1:158806084-158806106 AGGGAAAAAAGAGTTTCTGTTGG + Intergenic
915979765 1:160412765-160412787 AGGGAAACTATAATGACTGTAGG - Intronic
916190237 1:162171079-162171101 GGGGAAGACACAGGGGCTGTTGG + Intronic
916360470 1:163962126-163962148 AGGGACAGCACAGTTATTGTGGG + Intergenic
917171677 1:172183445-172183467 AAGGAAAATACAGTGATTCTGGG + Intronic
917306127 1:173627467-173627489 AGGGAGAGCACAGTGACTGTGGG + Intronic
917373210 1:174317941-174317963 AGGGAGAACACAGCAACTGTGGG - Intronic
917397037 1:174604346-174604368 AGGGAGAGGACAGTGATTGTGGG - Intronic
917810309 1:178652051-178652073 TGGGAAAACACATTTCCTGTGGG - Intergenic
918357892 1:183723505-183723527 AGGGAGAGTACAGTGACTGTGGG + Intronic
919012934 1:191988480-191988502 AGGGAGAACACAGCAACTGGGGG + Intergenic
919147336 1:193651935-193651957 AGGGAGAGCACAGTAACTGTGGG - Intergenic
919438509 1:197595405-197595427 AGGCAAACCACAGTGTCTGTAGG + Intronic
920143219 1:203835731-203835753 AAGGACAACACAGTGACTCCTGG - Intronic
920596827 1:207280192-207280214 AGGGAGAGCACAGTTACTGTGGG - Intergenic
920852886 1:209640600-209640622 AGGGAATGCACAGTGAGTGGTGG - Intronic
920953768 1:210598630-210598652 AGAAAGATCACAGTGACTGTGGG - Intronic
921002146 1:211055257-211055279 AGGAAAAACACAGTGATTGTGGG + Intronic
922388659 1:225114776-225114798 AGAGAGAGCACAGTGACTGTGGG - Intronic
924516319 1:244769011-244769033 AGGGAGAGCGCAGTGACTGGGGG - Intergenic
1063160207 10:3413194-3413216 CGGAAACACACAGTGTCTGTGGG - Intergenic
1066400312 10:35069610-35069632 AGAGAAATAACAGTGACTGAAGG + Intronic
1066708133 10:38203221-38203243 AGGGAGAGCACAGCAACTGTGGG + Intergenic
1067063517 10:43090256-43090278 AGGGAAGACACAGGGAATTTAGG + Intronic
1068124901 10:52827524-52827546 AGGGAGAGCAAAGTGACTGTGGG + Intergenic
1068894171 10:62181306-62181328 AGGGAATACAGAGTGAGTTTGGG + Intergenic
1069050571 10:63788305-63788327 AGGGAGAGCACAGTGACTGGGGG + Intergenic
1069336350 10:67356045-67356067 AGGGAAAACCCAGGAACTTTGGG - Intronic
1069881055 10:71593657-71593679 TGGGAAACCCCAGTGACTGGTGG + Intronic
1069911556 10:71762760-71762782 TGGGAAAACCCAGTGTCTGAGGG + Intronic
1070059556 10:72968675-72968697 AGGGAAAGTACAGTAACTGGGGG - Intergenic
1070330395 10:75412503-75412525 AAGGAAAACACAGGGCATGTGGG - Intergenic
1070635164 10:78119711-78119733 AGGGAAAACAAAGTTAGAGTGGG + Intergenic
1070832264 10:79425275-79425297 ACAGAAAACCCAGTGACTGCAGG - Intronic
1071295327 10:84215171-84215193 ACAGAAAACACACTGACTGTGGG + Exonic
1072901487 10:99411435-99411457 AGGGAAGAAACAATTACTGTTGG + Intronic
1073827212 10:107337478-107337500 AGGGAGATCACAGTGACTGGGGG - Intergenic
1074670051 10:115780154-115780176 AGGGAGAGCACAGTGATTGTGGG + Intronic
1074874075 10:117600880-117600902 GGGGCAAACACTGTGGCTGTGGG + Intergenic
1074917243 10:117969260-117969282 AGGGAACACACATTTACTGAGGG - Intergenic
1076376709 10:129993146-129993168 AAGGAAAGCACGGTGATTGTGGG + Intergenic
1077228291 11:1447759-1447781 CGAGAAAACACAGTTACTGACGG - Intronic
1077699713 11:4430336-4430358 AGGGTAAACACAGAGACCGTGGG - Intergenic
1078019335 11:7642228-7642250 AGAGGAAGCACAGTGACTGTAGG + Intronic
1079416299 11:20239182-20239204 AAGGAGAGCACAGTGACTGGGGG - Intergenic
1079532894 11:21476796-21476818 AGGGAGAGCACAATGATTGTGGG + Intronic
1080707252 11:34707941-34707963 AGGGCAAGCACAGTGACTAGGGG - Intergenic
1081245653 11:40763653-40763675 AGGGAAAGCACAGTGATTGTGGG + Intronic
1081522161 11:43892885-43892907 AGGGAGAAAACATTGACTGAGGG + Intronic
1081943844 11:46970111-46970133 AGGGACTAGACAGTGGCTGTAGG + Intronic
1082196172 11:49308892-49308914 AGGGGAAACACAGATACTCTGGG + Intergenic
1083059401 11:59853708-59853730 AGGGAAAACTCAGTAACTTATGG - Intronic
1083129976 11:60615937-60615959 TTGGAAAACACTGTGACTATGGG - Intergenic
1086902486 11:92383474-92383496 AGGGAAAACAAATACACTGTGGG - Intronic
1087473098 11:98601647-98601669 AAGGAAAGCACAATGATTGTAGG - Intergenic
1088038708 11:105350517-105350539 GGCCAAAACACAGGGACTGTAGG + Intergenic
1088330638 11:108647591-108647613 AGGGAGAGCAAAGTGAGTGTGGG + Intergenic
1088605003 11:111520967-111520989 AGGGAAAACACAGTATATCTAGG + Intronic
1088720517 11:112588138-112588160 AGAAAAAACTCAGTGCCTGTGGG - Intergenic
1088944582 11:114496313-114496335 AGGGAGAGCACAGTGATTGTGGG - Intergenic
1089344602 11:117782958-117782980 ATGGTTAAGACAGTGACTGTAGG - Intronic
1091314052 11:134598348-134598370 AAGGAAAAGAGAGTGACTGGAGG - Intergenic
1091754847 12:3044549-3044571 AGGTCAAACACAGGGACTGCTGG - Intergenic
1092477141 12:8828950-8828972 CGGGAGAGCACAGTGACTGTGGG - Intronic
1092657090 12:10697487-10697509 GGGGAAAACACACTGGTTGTAGG - Intergenic
1092991208 12:13901833-13901855 AGGTAAAATACAGAGACTATAGG - Intronic
1093931626 12:24960329-24960351 AGGAAGAGCACAGTGACTGTGGG + Intergenic
1094419680 12:30257476-30257498 AGGGAGAGCACAGTAACTATAGG + Intergenic
1094795742 12:33970272-33970294 AAGGAAAACAAAGTGATTGAGGG - Intergenic
1095101014 12:38183924-38183946 AGAGAGAGCACAGTGACTGGAGG + Intergenic
1095860141 12:46907802-46907824 AGGGAGAGTGCAGTGACTGTGGG + Intergenic
1096673336 12:53213287-53213309 GGGGAAGACACAGTGACAGATGG + Intronic
1096848529 12:54420800-54420822 AGGAAAAAAACATTGACTCTGGG - Intergenic
1098395201 12:70010213-70010235 AGGGACAGCACAGCAACTGTAGG + Intergenic
1099101011 12:78440094-78440116 AGGGAGAGCAAAGTGACTGTGGG - Intergenic
1099424005 12:82500736-82500758 AGAAAAATCACACTGACTGTTGG + Intergenic
1099610208 12:84858035-84858057 AGGGAAAGCACAGTGACTAAGGG - Intergenic
1099757785 12:86876891-86876913 AGGGAGAGCGCAGTGACTGTGGG - Intergenic
1099807831 12:87542812-87542834 AGGCAGAGCACAGCGACTGTAGG + Intergenic
1100388637 12:94127733-94127755 AAGGAGAACACAGTTTCTGTGGG - Intergenic
1100933191 12:99633863-99633885 AAGGAAGACACAGTGTCTGTTGG - Intronic
1101295845 12:103423119-103423141 AGGGACAACACAGTGACCCATGG - Intronic
1103401792 12:120648244-120648266 AGGGAAAACACAAAAACTCTGGG - Intronic
1103615269 12:122147879-122147901 AGGGGAACCACAGTGCCTGGAGG - Intergenic
1103951261 12:124552590-124552612 AGGGAAATCACAGGCTCTGTGGG + Intronic
1107765752 13:43732797-43732819 AGAGAAAATGCAGTGAGTGTTGG - Intronic
1108997132 13:56748224-56748246 AGGGAAAACACAATGAATTGAGG - Intergenic
1109639560 13:65172005-65172027 AGGAAAAACACAATGATGGTTGG - Intergenic
1110079046 13:71287473-71287495 AGAGAAAGCGCAGTGACTGTGGG - Intergenic
1110665874 13:78116770-78116792 AGGGAGAATGCAGTGACTGTGGG - Intergenic
1111639193 13:90946625-90946647 AGGGAGAGCATAGTGATTGTGGG + Intergenic
1111750496 13:92325423-92325445 AGGAATAACACAGCAACTGTGGG - Intronic
1111818633 13:93186661-93186683 GAAGAAAACACAGTGACTGCTGG + Intergenic
1111828136 13:93294909-93294931 AATGAAAACACAATGAATGTGGG - Intronic
1111906532 13:94261986-94262008 AAGGTAAACAGAGTGACTGAAGG + Intronic
1111939129 13:94590721-94590743 ATGGATAACACAGTCACCGTGGG + Intronic
1112944499 13:104910748-104910770 AGGGAGAGCACAGTGACTGGGGG - Intergenic
1113244428 13:108378253-108378275 AGGGATAGCACAGTGACTGTGGG - Intergenic
1113648180 13:112013480-112013502 AGGGAAAACATCGTGTCTGTAGG - Intergenic
1113834287 13:113318744-113318766 AGGGAGAAGGCAGTGAGTGTGGG - Intronic
1115133883 14:30086206-30086228 AGGGAGAGCACAGTGACTGGGGG + Intronic
1115643377 14:35349982-35350004 AAGTAAACCACATTGACTGTGGG - Intergenic
1116354700 14:43914009-43914031 AGGGACAGCACAGTGATTGTGGG + Intergenic
1116765844 14:49069923-49069945 GGGGAAAACACAGTGACTGTGGG + Intergenic
1117161617 14:52995341-52995363 AGGGAGAGCACAGTGACTATGGG - Intergenic
1117208572 14:53470823-53470845 AGAGAGAGCACAGTGATTGTGGG - Intergenic
1117384369 14:55195809-55195831 AGGGAGAGCGCAGTGACTGATGG - Intergenic
1117607108 14:57440959-57440981 AGAGAAAGAACAGTGATTGTGGG - Intergenic
1117870657 14:60197452-60197474 AGGGAGGACAAAGTGACTGTGGG + Intergenic
1118034282 14:61849623-61849645 AGGGAGAGCATAGTGATTGTGGG - Intergenic
1118431284 14:65720949-65720971 AGGGGGAGCACAGTGATTGTGGG - Intronic
1118695320 14:68379381-68379403 GGGGAAAACAGAGGGACTGCTGG + Intronic
1119465927 14:74858345-74858367 AGGCAAAACACACTGCCTCTTGG + Intronic
1119966867 14:78926203-78926225 AGGAAAAACACAGTGTATATAGG - Intronic
1120869509 14:89324508-89324530 AGGGAAAACAAAGCGGCAGTAGG + Intronic
1120894401 14:89516908-89516930 AGGCTAAGAACAGTGACTGTTGG - Intronic
1123538371 15:21261729-21261751 CGGGAAACCACAGTGGGTGTGGG + Intergenic
1124085506 15:26546437-26546459 ACAGCAAACACAGTCACTGTTGG - Exonic
1124217119 15:27816696-27816718 AGGGAAAATTCAGTAGCTGTAGG - Intronic
1126865414 15:52932051-52932073 AGGGAACACAGAGTGATTATAGG + Intergenic
1127101201 15:55566685-55566707 AGGGAATGCACATAGACTGTTGG - Intronic
1127191090 15:56531341-56531363 AGGGAAAAGAGAATTACTGTGGG + Intergenic
1127791794 15:62404966-62404988 TGGGAAAACTCAGTGACTCGAGG + Intronic
1128378334 15:67093098-67093120 AGTGAAAAGATAGTAACTGTAGG - Intronic
1129388175 15:75207164-75207186 AAGGAAAACTCAGTGTCTGGGGG - Exonic
1129477594 15:75796541-75796563 AGGGAGAATACAGCAACTGTGGG - Intergenic
1130058459 15:80551092-80551114 ATCGAAAATACAGTGAGTGTTGG - Intronic
1130430543 15:83842686-83842708 TGTGAAAACAGAGTGATTGTAGG + Intronic
1130623241 15:85486094-85486116 AGGTAAATCACAGTGGCAGTAGG - Intronic
1131005375 15:88973220-88973242 AGGGAAAACACAAGGTCTGGGGG - Intergenic
1131687859 15:94790296-94790318 AGGGAAAACACAGTAGATGGAGG + Intergenic
1135992264 16:27225254-27225276 AGGAAAGACACAGTGAATGGAGG + Intronic
1138257550 16:55579885-55579907 AGAGAAAAGACAGTTACTGATGG - Intronic
1138418928 16:56886797-56886819 AGGGAAAACACAAGGAGTGGGGG - Intronic
1138806933 16:60100906-60100928 AGAGCGAGCACAGTGACTGTGGG - Intergenic
1139005041 16:62559487-62559509 AGGGAGAGTGCAGTGACTGTGGG - Intergenic
1141098615 16:81180720-81180742 AGGCAAAAAACAGTTACTGGAGG + Intergenic
1141205084 16:81927307-81927329 AGGGAAGACACAGTGATGATAGG + Intronic
1142180291 16:88665540-88665562 AGGGAATACACCCTGACTATAGG - Intergenic
1142774052 17:2122432-2122454 AAGGAAAACACAGTGTCAGAGGG + Intronic
1144458266 17:15436712-15436734 AGGGCAAACAAAGTGGCAGTGGG - Exonic
1144772511 17:17767758-17767780 AAGGAAAACACTGAGACTCTTGG - Intronic
1145201016 17:20944751-20944773 AGGGAGAGCTCAGTGATTGTGGG - Intergenic
1145723108 17:27090677-27090699 TGGGAAACCACAGTGGGTGTGGG - Intergenic
1146098965 17:29960133-29960155 AGGGAGAGCACAGTGACTGTGGG - Intronic
1146260537 17:31417418-31417440 GGGGAAAGGACAGTGCCTGTGGG - Intronic
1147322764 17:39656253-39656275 AGGGAGGACACAGGGACTCTGGG - Intronic
1148841817 17:50503667-50503689 AGGGATGACACAGAGACTCTGGG - Intergenic
1149188436 17:54029953-54029975 AGAGAGAGCACAGTGATTGTGGG + Intergenic
1149371279 17:55995597-55995619 TGGTAAAAGACAGTGGCTGTAGG + Intergenic
1150336976 17:64337440-64337462 AGGGATAATACAGTGACTGTGGG + Intronic
1150473637 17:65458089-65458111 AAGGAAAACCCAGTGGCCGTTGG + Intergenic
1150541391 17:66103824-66103846 AGGAAGAGCACAGTGATTGTGGG + Intronic
1152376285 17:79920431-79920453 CAGCAAAACACAGTGCCTGTGGG + Intergenic
1152741959 17:82022389-82022411 AGGGAAACCACTGTGCCTGGCGG + Intronic
1152745321 17:82036136-82036158 AGGGCACACACAGGGACTGCTGG + Intronic
1152891969 17:82887299-82887321 AGGGAAACAGCAGGGACTGTGGG - Intronic
1153356707 18:4144413-4144435 AGGGAGAACACAGTGATTGTGGG - Intronic
1153713216 18:7820606-7820628 AGGGAACACACTCTGACTGGGGG - Intronic
1153765370 18:8369556-8369578 AGGAAGAGCGCAGTGACTGTGGG + Intronic
1153865103 18:9260393-9260415 AGGAAAAACAAACTGACTCTGGG - Intronic
1155443292 18:25884416-25884438 AGGGAGAGCACAGTGATTGTGGG + Intergenic
1155767349 18:29652369-29652391 AGGGAGAATGCAGTGAATGTGGG + Intergenic
1155792757 18:29995471-29995493 AGGGAGCGCATAGTGACTGTGGG + Intergenic
1156000902 18:32382728-32382750 AAGGGAGACACAGTCACTGTAGG + Intronic
1156159689 18:34344582-34344604 AAGGTGAACAGAGTGACTGTGGG - Intergenic
1156860732 18:41833427-41833449 ATGGAAAAAGAAGTGACTGTTGG + Intergenic
1156977356 18:43238629-43238651 AGGGGCAACACAGTGACTGGAGG - Intergenic
1157169924 18:45393802-45393824 AGTGAGAACTCAGTGAGTGTTGG - Intronic
1157698882 18:49746856-49746878 AGAGAAAACAGAATGAATGTGGG - Intergenic
1157991723 18:52504516-52504538 AAGTAAAGCACAGTGGCTGTGGG + Intronic
1158138560 18:54232175-54232197 AGAGAAGCAACAGTGACTGTGGG + Intergenic
1158845217 18:61434940-61434962 AGGGTAAACACAGGAACTCTAGG - Intronic
1159403192 18:67963838-67963860 AGGGAAAAGAGAAAGACTGTTGG - Intergenic
1160087122 18:75786839-75786861 AGGGAAAACATAGTAACTTCTGG + Intergenic
1163559418 19:18010072-18010094 AGGGAATACAGGGTGAATGTAGG - Intronic
1164391191 19:27822617-27822639 AGGTAAAACACTGTTACTGGGGG + Intergenic
1165264144 19:34646489-34646511 TGGACAAACACAGTGAGTGTGGG - Intronic
1167613111 19:50516860-50516882 AGAGAAAACAAAGTGAATGTGGG - Intergenic
1168081284 19:54012272-54012294 AGGGAGAACACAGTTTCTCTAGG - Exonic
1168265396 19:55220808-55220830 AGGGAAAACCCAGTCTCTCTCGG + Intergenic
1168683001 19:58329537-58329559 AGAGAAAACAAATTCACTGTGGG + Intronic
925194883 2:1914832-1914854 ATGGAAAAGACAGTGGTTGTGGG - Intronic
925506439 2:4569891-4569913 AGAGAAAACACAGTGATTGTGGG - Intergenic
925526175 2:4804876-4804898 TGGGAAAATACACTGACTTTGGG + Intergenic
926518750 2:13883412-13883434 AGGGAGAGCACAGTGATTGCGGG + Intergenic
926527002 2:13993066-13993088 AGGCAAAAGACAGTGTGTGTAGG + Intergenic
927735165 2:25514132-25514154 AGAGGAAACAGAGTGACTGATGG + Intronic
928293443 2:30060606-30060628 AGGGAAAACACAGTGATTCTGGG + Intergenic
928483956 2:31710992-31711014 AGGGAGAGCAAAGTGATTGTGGG + Intergenic
928847610 2:35696689-35696711 AGGGAGAGCAAAGTGACTGGGGG - Intergenic
929281837 2:40088203-40088225 AAGGAAAGTGCAGTGACTGTGGG - Intergenic
930288943 2:49468769-49468791 AGGGAGAGCACAGTGATTGTGGG - Intergenic
930439784 2:51391220-51391242 AGGGAGAGTACAGTGACTGGGGG - Intergenic
930546971 2:52780547-52780569 AGGTAAAACACAATGAGTATAGG + Intergenic
930895546 2:56441412-56441434 AGGTAGAGCACAGTGATTGTGGG - Intergenic
931117951 2:59184796-59184818 GGTGAAAACACTGTGACTGAAGG - Intergenic
931530071 2:63204165-63204187 AGGGAAAACTCATACACTGTTGG - Intronic
935619278 2:105114605-105114627 GGGGAAAATACAGTGATTTTTGG + Intergenic
935621782 2:105136345-105136367 AAGGAATACACAGTCAGTGTGGG - Intergenic
936125051 2:109781871-109781893 AGGAAAACCTCAGTGCCTGTAGG + Intergenic
936219642 2:110589597-110589619 AGGAAAACCTCAGTGCCTGTAGG - Intergenic
936264418 2:110991603-110991625 ATGGAAAACACAGTAAATGATGG + Intronic
936940504 2:117879297-117879319 AGGGAAAGTGCAGTGATTGTGGG - Intergenic
937379708 2:121365523-121365545 AGGGTGAAGACATTGACTGTTGG - Intronic
938587636 2:132707207-132707229 GGGGAAAGTGCAGTGACTGTGGG + Intronic
938721324 2:134069600-134069622 TGGGAAGACACAGTGACATTTGG - Intergenic
939344484 2:140946228-140946250 AGGGAACACACAGACACTGTTGG + Intronic
939501851 2:142996625-142996647 AGGGAACAGGCAGTAACTGTGGG + Intronic
940595925 2:155792965-155792987 AGGGAAAATACAGAGAATGGTGG + Intergenic
940795252 2:158070867-158070889 AGGGAGAGCACAGTGACTGTAGG + Intronic
941742138 2:169046599-169046621 AGGGAGAGCACAGTGACTGTGGG + Intergenic
941746094 2:169088292-169088314 AGGGAGAGCACAGTGATTGTGGG - Intronic
941858302 2:170252706-170252728 AGAGAATACAGAGTGACAGTTGG + Intronic
942294761 2:174506952-174506974 AGAGAAAGCACAGCGAGTGTCGG + Intergenic
942881796 2:180870665-180870687 AGGGAGAGTGCAGTGACTGTGGG + Intergenic
943117607 2:183692442-183692464 AGGGAGAGCACAGTGAATGGGGG - Intergenic
943237335 2:185338843-185338865 AGAGAGAGCACAGTGACTGTGGG - Intergenic
943933490 2:193885306-193885328 AGGGAGAATAAAGTGACTGGTGG + Intergenic
944129785 2:196335327-196335349 AGAGAAATTCCAGTGACTGTAGG - Intronic
944133379 2:196370828-196370850 AGGGAGAATGCAGTGATTGTGGG - Intronic
944928906 2:204495822-204495844 AAGGAAAAAAGAGTGATTGTGGG - Intergenic
947505344 2:230704243-230704265 AGGGAGAGCACAGTGATTGCAGG - Intergenic
948291210 2:236826251-236826273 AGGGAAGCCACAGTGTCAGTGGG + Intergenic
948475616 2:238217116-238217138 GGAGAGAACACAGTGATTGTGGG - Intergenic
948612125 2:239176402-239176424 AGGGCAAAGAGAGTGAGTGTGGG - Exonic
948774555 2:240277081-240277103 AGGGAGAGAGCAGTGACTGTGGG + Intergenic
948877071 2:240835230-240835252 AACAAAAACACAGTCACTGTGGG - Intergenic
1168748203 20:263170-263192 AGGGAGAGCACAGTGATTGTGGG + Intergenic
1169988613 20:11474248-11474270 AGGGAGAGCACAGTGATTGTGGG + Intergenic
1170395335 20:15919812-15919834 AGGGAAAAGACAGAGACCATTGG + Intronic
1170460804 20:16574829-16574851 AGGGAAAACCCAGTGATTTCCGG - Intergenic
1170668266 20:18405886-18405908 AGGGAGAGCACAGTGACTGGGGG + Intronic
1170864221 20:20138508-20138530 AGAGAAAGTGCAGTGACTGTGGG - Intronic
1171819704 20:29823564-29823586 AGGGAGAGCACAGTGACTGGAGG - Intergenic
1171898116 20:30829615-30829637 AGGGAGAGCACAGTGACTGGAGG + Intergenic
1171979510 20:31617645-31617667 AAGGAAACCAAAGTGACTGGAGG - Intergenic
1173020260 20:39261277-39261299 AAGGAAAACAAGGAGACTGTGGG - Intergenic
1173713456 20:45180466-45180488 AAGGACAACAAAATGACTGTGGG + Intergenic
1174977115 20:55348622-55348644 GGGGAAAACACAGGGCTTGTGGG + Intergenic
1174998499 20:55599914-55599936 GTGGAAAACACAGTGATGGTGGG + Intergenic
1176421686 21:6521176-6521198 ATGGAAAACACAGGGTCAGTGGG + Intergenic
1177260586 21:18724891-18724913 AGGGGAAAAACAGTGGCTATTGG - Intergenic
1177692699 21:24531890-24531912 AGAGACAACACAGTAATTGTGGG + Intergenic
1179570227 21:42274188-42274210 AGGGAAAATACAGGGAAGGTGGG + Intronic
1179697176 21:43129492-43129514 ATGGAAAACACAGGGTCAGTGGG + Intergenic
1180323704 22:11348255-11348277 AGGGAGAGCACAGTGACTGGAGG - Intergenic
1183010524 22:34943065-34943087 GGGGAGAACACTGTGACTTTGGG + Intergenic
1183247989 22:36708753-36708775 AGGATGAACACAGGGACTGTGGG - Intergenic
1183523467 22:38310089-38310111 AGAAAAAACACAGGGACTTTGGG - Intronic
1203293110 22_KI270736v1_random:14601-14623 TAGGAAAACACAGTGAGTTTAGG - Intergenic
950007464 3:9700662-9700684 CTGGAAACCACAGTGACTGAAGG + Intronic
950938952 3:16873980-16874002 AGGGAGTACACAGGGACTCTGGG - Intronic
951029399 3:17864124-17864146 AGGGAGAGCACAGTGACTGTGGG - Intronic
951129822 3:19029372-19029394 AGGGAGAGCAAAGTGATTGTGGG + Intergenic
951437096 3:22677188-22677210 AGGGATAGCACAGTGATTGTGGG - Intergenic
951929271 3:27945464-27945486 TGGGAAAAGACAGTGAATCTAGG + Intergenic
952412116 3:33058785-33058807 AGGGAAAACACAATTACAATTGG - Intronic
952812011 3:37412334-37412356 AGGAACAGCACAGTGATTGTGGG - Intronic
953024025 3:39134580-39134602 GGGGAAAGCACATTCACTGTAGG + Intronic
954491478 3:50910709-50910731 AGGGAGAACAAAGTGACTGTGGG - Intronic
955594630 3:60575160-60575182 AGGAAAAAGAAAGCGACTGTTGG + Intronic
956483491 3:69696663-69696685 AGGGAAAACATAGTAACTTCTGG - Intergenic
957485589 3:80858413-80858435 AGGGAGAGCACAGTGATTGAGGG + Intergenic
957538098 3:81532020-81532042 AGGGAAAACACAGTGACTGTGGG - Intronic
957965724 3:87320984-87321006 AGGGAGAGTACAGTGATTGTGGG + Intergenic
958147005 3:89639277-89639299 AGAAAGAATACAGTGACTGTGGG + Intergenic
958670522 3:97197976-97197998 AGGGAGAGCACGGTGATTGTAGG - Intronic
958682691 3:97352489-97352511 AGAGAGAATGCAGTGACTGTGGG + Intronic
959126059 3:102291325-102291347 AAGGAGAGCACAGTGATTGTGGG - Intronic
959868576 3:111300352-111300374 AAGGAGAGCACAGTGATTGTGGG - Intronic
960341585 3:116480686-116480708 AGGGAAAACTTAGACACTGTTGG + Intronic
960404029 3:117238062-117238084 AGGGACAGCACAGTGATTGTGGG + Intergenic
960840933 3:121957918-121957940 AGGGAAAGCACCGTAATTGTGGG + Intergenic
961025509 3:123552202-123552224 AGGGAAGAGACAGAGTCTGTGGG + Intronic
961569276 3:127786477-127786499 AGGGAGAAGGCAATGACTGTGGG + Intronic
962454712 3:135554417-135554439 AAGGAAAACACAGTGAGCCTAGG + Intergenic
962997976 3:140650720-140650742 AGGGAGAGCAAAGTGATTGTGGG + Intergenic
963154023 3:142077043-142077065 AGGGAGAGCTCAGTGACTGTGGG + Intronic
963528851 3:146447985-146448007 AGGGAGAACACAGTGATTGTGGG - Intronic
964094326 3:152914071-152914093 AGGAAAAAGACAATGACTTTGGG - Intergenic
964259037 3:154812391-154812413 AGGGAGAGCACAGTGATTGTGGG - Intergenic
964583008 3:158260866-158260888 AGGGAAAGTACAGTGATTGTGGG - Intronic
964945061 3:162211577-162211599 AGGGAAAACAGAGTCTTTGTTGG - Intergenic
965256984 3:166425751-166425773 AAGGAGAGCACAGTGACAGTGGG + Intergenic
965264052 3:166518184-166518206 AGGGAAAGTGCAGTTACTGTGGG + Intergenic
965379141 3:167966775-167966797 AGGGAAAGCACAGTGATTTTAGG + Intergenic
965486979 3:169290246-169290268 GGGAAAAACACAGTAACTGGGGG + Intronic
965535362 3:169818169-169818191 AGGGAGAGGAAAGTGACTGTGGG - Intergenic
965844395 3:172945580-172945602 AGGGAGAATACAGTAATTGTGGG + Intronic
965853942 3:173065698-173065720 AGGGAAAGTAAAGTGAGTGTGGG + Intronic
966454107 3:180095059-180095081 AGGGAGAACACGGTGATTGTGGG - Intergenic
966489471 3:180511332-180511354 AAAGAAAACAAAGTGAGTGTGGG + Intergenic
966552782 3:181223615-181223637 AGGGAAGTCCCAGTGACTGAAGG - Intergenic
967697061 3:192544177-192544199 AGGGAGAGCACAGTGATTGTGGG - Intronic
971795052 4:31216475-31216497 AGGGAAAACAAATTGTCAGTGGG + Intergenic
972253678 4:37331879-37331901 AGGGAGAGTACAGTGATTGTGGG + Intronic
972271200 4:37512035-37512057 AGGGAGAGCACAGTGATTGTGGG - Intronic
973287945 4:48440428-48440450 AGGGAGAGCACAGTGACTGTGGG - Intergenic
973348443 4:49082258-49082280 AGGGAAAGTGCAGTGATTGTGGG + Intergenic
973540359 4:51928971-51928993 AGGGAACACACAGAGACTTCAGG + Intergenic
974224361 4:59019227-59019249 AGAGAAAGCACAGTGATTGTCGG - Intergenic
975295139 4:72726123-72726145 AGGGAGAGCACAGTGATTGTGGG + Intergenic
976109188 4:81652780-81652802 AGTTAAAACAAAGTGTCTGTGGG + Intronic
978096419 4:104784456-104784478 AGAGAAAGCACAGAGACTGTGGG - Intergenic
978478245 4:109157137-109157159 AGGAAGAGCACAGTGACTGAAGG + Intronic
978654252 4:111048211-111048233 AGGGAGAGCACAGTGATTGTGGG + Intergenic
978755215 4:112294261-112294283 AAGGCAATCACAGTGACTGATGG - Intronic
978934726 4:114360283-114360305 AGGGAGAGCACAGAGACTGCCGG - Intergenic
979111271 4:116761152-116761174 AGGGGAAGCACGGTGATTGTGGG + Intergenic
979213391 4:118133372-118133394 AGGGAGAGCACAGTGACAGGGGG - Intronic
979945725 4:126829535-126829557 AGGGAAAGCACAGTGATTGCGGG + Intergenic
980442487 4:132867115-132867137 AGGGAGAACACAGCAACTGGAGG + Intergenic
980467580 4:133204927-133204949 AGGGAACAACCAGGGACTGTGGG + Intronic
980842058 4:138275562-138275584 AGGGAAAGCCCATTCACTGTTGG + Intergenic
980956505 4:139434025-139434047 AGGGAGATCGCAGTGATTGTGGG - Intergenic
981140122 4:141258677-141258699 AGGGAGAACACAGTGATTGTGGG + Intergenic
981942592 4:150299648-150299670 ATGGAAAAAACAGTGTATGTAGG + Intronic
982170779 4:152659795-152659817 AGAAAAAACACAGTGTATGTGGG - Intronic
982817657 4:159906741-159906763 AGTGAGAGCACAGTGACTGTAGG + Intergenic
983338182 4:166422024-166422046 AGGGAGAGCACAGTGACTGTGGG - Intergenic
983417627 4:167479369-167479391 AGGGAGAGCAAAGTGACTGTGGG + Intergenic
983522383 4:168723256-168723278 AGGGAAGACAGAATGACTGTAGG + Intronic
984220914 4:176973405-176973427 AGGGAAAACACAGGGAAACTGGG + Intergenic
984572967 4:181415369-181415391 AGAGAAAATACACTGACTCTGGG - Intergenic
985124652 4:186681086-186681108 AGGGAAACAAGAGTGAATGTAGG + Intronic
985347024 4:189016947-189016969 AGAGAAAATACAGTTCCTGTTGG - Intergenic
985487367 5:158980-159002 AGGGAAACTAAAGTGACTGCTGG - Intronic
985880934 5:2638607-2638629 AGGGAAACCACCGTGAATGGAGG + Intergenic
988165591 5:27585254-27585276 AGGGAATACTTAGAGACTGTTGG - Intergenic
988616898 5:32783578-32783600 AGGGAGAACAAAGTGAATATAGG + Intronic
988930201 5:36029672-36029694 AGGATGAACACAGTGACTGAAGG + Intergenic
991209249 5:64085212-64085234 AGGGAGAGTGCAGTGACTGTGGG - Intergenic
991282247 5:64928182-64928204 TGAGGAAACACAGTGAATGTGGG - Intronic
992384169 5:76267830-76267852 AGGGACATCACATTGACAGTGGG + Intronic
992531913 5:77660116-77660138 AGGGAAAGTGCAGTGATTGTGGG - Intergenic
992934418 5:81687191-81687213 AGGGAGAGCACAGTGACTGTGGG + Intronic
993279264 5:85904750-85904772 AGGGAAAGTGCAGTGACTGAGGG + Intergenic
993876053 5:93308423-93308445 ATTGAAAACACATTGACAGTAGG + Intergenic
993932315 5:93954957-93954979 AGGGAGAGCACAGTGACTGTGGG - Intronic
994000839 5:94777129-94777151 ATGGAAAACACACTGCTTGTCGG + Intronic
994631887 5:102296690-102296712 TGGGAACACACAGAGACTGTGGG + Intergenic
995265185 5:110151839-110151861 AGGCAGAGCACAGTGACTGGGGG + Intergenic
995290372 5:110444374-110444396 AGGGAGAGCTCAGTGACTGGGGG - Intronic
995421632 5:111974105-111974127 AGGGAAAACACAGTCACGGTAGG - Intronic
995614354 5:113944306-113944328 AGTGAAAGCACAGTGAATGCTGG + Intergenic
996081073 5:119258802-119258824 AGGGAACACTCAGACACTGTTGG + Intergenic
996659856 5:125988954-125988976 AGGGACAGCAAAGTGATTGTGGG - Intergenic
996906691 5:128608971-128608993 AAGAACAGCACAGTGACTGTGGG - Intronic
997253469 5:132409592-132409614 AGGTAAACCAAAGTGACTCTGGG + Intergenic
997437824 5:133887703-133887725 AGGGACAGTCCAGTGACTGTGGG + Intergenic
998633920 5:143931481-143931503 AGGGAGAGCACAGAGACTGGAGG + Intergenic
999279465 5:150355488-150355510 AGGGAGAAGACAGTGTATGTGGG - Intergenic
1000608718 5:163352108-163352130 AGGGAGAACCCAGAGAATGTAGG + Intergenic
1000808281 5:165825983-165826005 AGGGAAAACAAAGAGAATTTTGG - Intergenic
1000973858 5:167743305-167743327 AGGGAAAACATGGGGACTGAGGG + Intronic
1003567339 6:7231845-7231867 AGGGAAAACCCGGGGACAGTGGG - Exonic
1008101147 6:47392495-47392517 AGGGAGACAACAGTGACTGTGGG - Intergenic
1008940396 6:57040183-57040205 AGGGAAAGCACAGCAACTGGAGG + Intergenic
1009728137 6:67560547-67560569 AGGGAGAGCAAAGTGATTGTGGG - Intergenic
1009823750 6:68839901-68839923 AGGGAGAGCACAGTGATTGTGGG + Intronic
1009978786 6:70701664-70701686 AGGGAGAACGCAGTGATTGTGGG - Intronic
1010062272 6:71636478-71636500 AGGGAGAGCACAGTGATTGTGGG - Intergenic
1012059769 6:94463420-94463442 AAGGAAAGCTCAGTGATTGTGGG - Intergenic
1012073796 6:94657774-94657796 AGGGAGAAAGCAGTGACTGATGG - Intergenic
1012247494 6:96942155-96942177 AGCTAACAAACAGTGACTGTGGG - Intronic
1012827233 6:104162173-104162195 AGGGAGAACGCAGTGACCATGGG + Intergenic
1012892005 6:104907577-104907599 AAGGAAAGCACAGTGATTGTGGG + Intergenic
1013653713 6:112223898-112223920 AGTGAAAACACAGAGGCTATTGG + Intronic
1013838816 6:114365301-114365323 AAGGAAAATACATTAACTGTGGG - Intergenic
1015392788 6:132701848-132701870 AAGGAAAGTACAGTGATTGTGGG + Intronic
1015460595 6:133487086-133487108 AGGGAGAGCTCAGTGAGTGTAGG + Intronic
1016054843 6:139567520-139567542 AGGAAGAGCACAGTGATTGTGGG - Intergenic
1016457463 6:144245762-144245784 AGGGAGAGCACAGTGATTGTGGG - Intergenic
1017529372 6:155273610-155273632 AGGGAAAACACTGTATCTGGAGG - Intronic
1018364943 6:163110459-163110481 AGGGGATGCAGAGTGACTGTTGG - Intronic
1018786454 6:167111962-167111984 AGAGAAAAAACTGTGGCTGTTGG + Intergenic
1019255069 7:44363-44385 ATGGACAACACAAGGACTGTTGG + Intergenic
1019844638 7:3485433-3485455 AGGGAAAGCAAAGTGAGTGTGGG - Intronic
1020624195 7:10557901-10557923 AGGGAAAGCACAGCAACTGGGGG + Intergenic
1021214740 7:17901609-17901631 AGGGAGAGCACAGTGATTATGGG - Intronic
1021842547 7:24732628-24732650 AGGGAGAGCACAGCAACTGTGGG + Intronic
1021855317 7:24849448-24849470 AGGGAAGTCACAGACACTGTCGG + Intronic
1021922978 7:25505713-25505735 AGGGACAGCACAATGACTGTAGG + Intergenic
1022542094 7:31146833-31146855 AGGGAGAGCACAGTGATTGTGGG - Intergenic
1022749992 7:33214290-33214312 AGGGACAGCACAGTGACTTGAGG - Intronic
1023716136 7:43046303-43046325 AGTGACAGCACAGTGATTGTGGG + Intergenic
1024210946 7:47203406-47203428 ATGGAAAAAAAAGTGACTGAGGG + Intergenic
1024369222 7:48560323-48560345 AGGAAGAGCACAGTGACTGGGGG - Intronic
1024956469 7:54926456-54926478 AGGGAGAGCACAGTGACTGGAGG + Intergenic
1027826101 7:83118544-83118566 AGGGAGAGCAAAGTGATTGTAGG + Intronic
1027921286 7:84399125-84399147 AGGAAAAGCACGGTGAGTGTGGG + Intronic
1028684473 7:93576054-93576076 ATGGAAACATCAGTGACTGTAGG + Intergenic
1028868178 7:95737092-95737114 AAGGAGAACCCAGTGACTGTGGG - Intergenic
1028929664 7:96398414-96398436 AGGGAGAATGCAGTGATTGTGGG - Intergenic
1029502002 7:100937285-100937307 AGGGAACACTCATTCACTGTTGG - Intergenic
1030226814 7:107161943-107161965 AGGGAAAGCACCGTCACTCTTGG - Intergenic
1031243857 7:119281647-119281669 AGGGAGAGCACAGTGACTGGGGG - Intergenic
1031412599 7:121457440-121457462 AGGGAGAATGCTGTGACTGTGGG - Intergenic
1031721809 7:125186645-125186667 AGAGAGAGCACAGTGATTGTGGG + Intergenic
1031746638 7:125506473-125506495 AGGGAGAACACAGCAACTGGAGG - Intergenic
1031862198 7:126993674-126993696 AGGGAGAGCACAGTGACTGGGGG + Intronic
1033542474 7:142369605-142369627 AGGGAGAGTGCAGTGACTGTGGG - Intergenic
1033814120 7:145051648-145051670 AGAGAAAGCACGGTGATTGTGGG - Intergenic
1034112486 7:148551117-148551139 AGGGAACACATAGACACTGTTGG - Intergenic
1034126286 7:148674826-148674848 AGGGAGAGCACAGTGATTGTGGG + Intergenic
1034387585 7:150753313-150753335 AGGGCAAACTGAGTGCCTGTAGG + Intergenic
1034847914 7:154464261-154464283 AGGGAGAATGCAGTGACTGTGGG - Intronic
1035355747 7:158275177-158275199 AGGGACAGCACCGTGGCTGTGGG + Intronic
1036075247 8:5491634-5491656 ATGGAAGAAACAGTGAATGTTGG + Intergenic
1036634889 8:10542299-10542321 AGGGAAACAACAATGTCTGTTGG + Intronic
1037880400 8:22570881-22570903 GGGGAAAAGTCAGTGTCTGTGGG - Intronic
1038342526 8:26698902-26698924 ACAGGAAACACAGTGAGTGTTGG + Intergenic
1039126467 8:34207847-34207869 AAGGAAAATAAAGTAACTGTTGG + Intergenic
1039266180 8:35826585-35826607 AGTGAACACACAGTGAAAGTGGG + Intergenic
1039681921 8:39748804-39748826 AGAGAATATACAGTCACTGTTGG - Intronic
1040294958 8:46144352-46144374 ACGGAAACCACAGGGAATGTTGG - Intergenic
1040929994 8:52723551-52723573 AGGGACAGAATAGTGACTGTTGG - Intronic
1041222581 8:55666123-55666145 AAGGAAAGCACAGTGACACTGGG + Intergenic
1041744881 8:61197878-61197900 AGGGAGAGAACAGTGACTATAGG - Intronic
1041820625 8:62028472-62028494 AGGGAATACACTGTGACTTTAGG - Intergenic
1042893423 8:73638380-73638402 AAGCAATACACAGTCACTGTTGG - Intronic
1043029679 8:75118335-75118357 AGGGGAAAAACAGTGACTAGTGG - Intergenic
1044635550 8:94320205-94320227 AGGGAGAGCACAGTGATTGCAGG - Intergenic
1045592599 8:103614341-103614363 AGGGAGAGCATAGTGACTGGGGG - Intronic
1046811542 8:118538558-118538580 AGGGAGAGCACAGTGATTGTGGG - Intronic
1047080764 8:121457930-121457952 AGAGAAAACAGATGGACTGTAGG - Intergenic
1047700240 8:127442430-127442452 TGGGAAAACGCAGGGAATGTGGG - Intergenic
1047996704 8:130343366-130343388 AGGGAAAAAGGAGTGAGTGTGGG - Intronic
1048118673 8:131554819-131554841 AGGGAGAGCACAGTGACTGTGGG + Intergenic
1048966540 8:139618895-139618917 ATGGAGAACATGGTGACTGTGGG - Exonic
1049652724 8:143780940-143780962 AGGGAACACACACACACTGTTGG - Intergenic
1050588044 9:7133689-7133711 AGGGAAAACACAGATCCAGTAGG + Intergenic
1050644410 9:7703295-7703317 AGGGAGAATACAGTCACTGAGGG - Intergenic
1051039219 9:12785665-12785687 AGGGAGAATACAGTGATTATGGG - Intronic
1051306618 9:15717181-15717203 AGGGAGAGCACAGTGATTGTGGG + Intronic
1051464941 9:17367190-17367212 AGGGAGAATGCAGTGACTGTTGG + Intronic
1051880946 9:21839433-21839455 AGGCAAAATACAGTGACTTGGGG + Intronic
1052093881 9:24361733-24361755 AGGGAGAGCACAGTGATTGTGGG + Intergenic
1052450602 9:28625284-28625306 AGGGAGAACACAGTGACTTAGGG - Intronic
1053317144 9:37061617-37061639 AGGGGTAACACAGTTACGGTGGG - Intergenic
1053501273 9:38595826-38595848 AGGGAAAAGACATTGGCTTTAGG - Intergenic
1053750690 9:41251412-41251434 AGGGAGAGCACAGTGACTGGAGG + Intergenic
1054256202 9:62815755-62815777 AGGGAGAGCACAGTGACTGGAGG + Intergenic
1054335103 9:63799859-63799881 AGGGAGAGCACAGTGACTGGAGG - Intergenic
1054982462 9:71222757-71222779 AGGCAGAGCACAGTGATTGTGGG + Intronic
1055011801 9:71574718-71574740 AGCAAAAACAGAGGGACTGTTGG + Intergenic
1056230693 9:84539728-84539750 AGGGAGAACACAGTGATTGTGGG - Intergenic
1056271703 9:84953927-84953949 AAGGCAAAGACAGTCACTGTAGG + Intronic
1056289388 9:85127466-85127488 AGGGAAAACACAGATATTGGGGG - Intergenic
1056338703 9:85602853-85602875 AGAGAACATGCAGTGACTGTGGG + Intronic
1056516665 9:87358799-87358821 AGAGAAAGTGCAGTGACTGTGGG + Intergenic
1056609388 9:88114862-88114884 CGGGAAATCACAGTGGGTGTGGG - Intergenic
1057515803 9:95719390-95719412 AGAGAAAAAACAGTGAGCGTGGG + Intergenic
1057765417 9:97912997-97913019 ATGGAAAACACATAGACTGGTGG - Intronic
1058285363 9:103170065-103170087 AGGGAGAGGGCAGTGACTGTGGG - Intergenic
1058820773 9:108727679-108727701 AGGGAAAGCACAGTGATTGCTGG + Intergenic
1059729388 9:117041920-117041942 AGGGGAAACACAATGAATATGGG - Intronic
1059886566 9:118751080-118751102 AGGGACAGCACAGTGATTGTGGG + Intergenic
1060586743 9:124791145-124791167 AGGGACATCCCAGGGACTGTGGG + Intronic
1061080330 9:128365891-128365913 AGGGAGAACACGGGGCCTGTGGG - Intergenic
1061233410 9:129328124-129328146 AGGGACAACTCAGTGGCTGTGGG + Intergenic
1061638142 9:131928557-131928579 AGGGAGAGCACAGCGACTGGGGG + Intronic
1062042290 9:134409656-134409678 TGGGAAGTCACAGTGCCTGTGGG - Intronic
1062155744 9:135047150-135047172 AGGGCACACACAGTCACTGGGGG + Intergenic
1062454384 9:136628856-136628878 CTGGAAGACACAGTGATTGTGGG - Intergenic
1203371376 Un_KI270442v1:308829-308851 AGGGAGAGCACAGTGACTGGAGG - Intergenic
1186382356 X:9074200-9074222 AGGCAAAGCACAGTGACAGTGGG - Intronic
1186602034 X:11048606-11048628 AGGGAGAGCACAGTGTCTGGGGG - Intergenic
1186936173 X:14452033-14452055 AGGGAAAACTAAATGACCGTTGG + Intergenic
1187255684 X:17639830-17639852 AGGCTAAACACAGTGCCTTTAGG + Intronic
1187579422 X:20592506-20592528 AGGAAGAGCACAGTGACTGGAGG - Intergenic
1187636677 X:21237417-21237439 AGGGAGAACATAGTGACTGTGGG + Intergenic
1188232108 X:27677226-27677248 AGAGAACACACAGTGTTTGTGGG - Intronic
1188609004 X:32072475-32072497 AGAAAGAACACAATGACTGTGGG - Intronic
1188864549 X:35299450-35299472 ACGGAGAGCACAGTGATTGTAGG + Intergenic
1188938567 X:36208469-36208491 ACAGAAAATACAGTGTCTGTGGG - Intergenic
1188972404 X:36633562-36633584 AGGGAGAGCACAGTGATTATGGG - Intergenic
1189628051 X:42920737-42920759 AGGGAGAGCACAGTGATCGTGGG + Intergenic
1190122597 X:47674549-47674571 AGGGAGAACACAGTGAATGTGGG - Intergenic
1190724716 X:53181385-53181407 AGGGGAAACTCAGTGAGGGTTGG - Intergenic
1191593322 X:62913011-62913033 ATGTAAAAGACAGTGATTGTGGG - Intergenic
1191812497 X:65204037-65204059 AGAGAGAACACAATGATTGTGGG - Intergenic
1192134944 X:68588515-68588537 AGGAAGAACACAGTGACTAGGGG + Intergenic
1192374756 X:70548603-70548625 AGGGAGAGCACAGTGATTGTGGG + Intronic
1192875348 X:75223645-75223667 AGGGAAACTGCAGTGATTGTGGG - Intergenic
1193521957 X:82541442-82541464 AGGGAAAAAAAATTGCCTGTGGG + Intergenic
1193738353 X:85186634-85186656 AAAGAGACCACAGTGACTGTGGG - Intergenic
1193847439 X:86491714-86491736 AGAGAAAACAAAATGACAGTCGG + Intronic
1193931694 X:87561371-87561393 GGGGAAAGCAAAGTGATTGTAGG + Intronic
1193933198 X:87582386-87582408 AGGGATAACACAGCAATTGTGGG + Intronic
1194196733 X:90903554-90903576 AGAGAGAGCACAGTGACTGGCGG - Intergenic
1194388930 X:93292459-93292481 AGGGAGAATGCAGTGACTGGGGG + Intergenic
1194526369 X:94982843-94982865 TGGGAAAGTGCAGTGACTGTGGG + Intergenic
1194751287 X:97687130-97687152 AGCGAAAATACAGTGCATGTGGG - Intergenic
1194842077 X:98754821-98754843 AGGGAGAGCACAGTGACTGGGGG - Intergenic
1195290155 X:103424428-103424450 AGGGAGAGCACAGTGATTGTGGG - Intergenic
1195472365 X:105245221-105245243 AAGTAAAACACAGAGACTGATGG - Intronic
1195601225 X:106751277-106751299 AAGGAGAGCACAGTGATTGTGGG + Intronic
1195948931 X:110246728-110246750 AGGGAAGAAACAGTAACTCTGGG + Intronic
1196217702 X:113072668-113072690 AGGGAGAGCTCAGTGATTGTGGG - Intergenic
1196357470 X:114810559-114810581 AGGGAGAATGCAGTGACTGTGGG - Intronic
1196368742 X:114951974-114951996 AGGGAGAGCAAAGTGATTGTGGG + Intergenic
1196384963 X:115139690-115139712 AGGGAGAGCACAGGGACTGGGGG + Intronic
1196532642 X:116806793-116806815 AGAGACAGCACAGTGACTGGGGG - Intergenic
1196619479 X:117806333-117806355 CAGGAGAGCACAGTGACTGTGGG + Intergenic
1197011478 X:121569974-121569996 AGGGAAAGTACAATGATTGTGGG + Intergenic
1197078296 X:122379061-122379083 AGGGAGAGCACAGTGACTGAAGG - Intergenic
1197099676 X:122637407-122637429 AGGGAGAGCGCAGTGACTGTGGG - Intergenic
1197399871 X:125977356-125977378 AGGGAAAGCAAAGTGATTGTGGG + Intergenic
1197439220 X:126470281-126470303 AGGGAAAGCATAGTGATTGTGGG + Intergenic
1197457903 X:126700979-126701001 AGGGAGAGCACAGTGACTGGGGG + Intergenic
1197514697 X:127411270-127411292 AGAGACAGCACAGTGATTGTGGG - Intergenic
1197623650 X:128779835-128779857 AGGGAGAGCACAGTGACTGGGGG - Intergenic
1197670702 X:129273798-129273820 AGGGAAAGCACAGTGATTGTGGG - Intergenic
1198724785 X:139665474-139665496 AGGGAGATCACAGAAACTGTGGG - Intronic
1198761561 X:140038345-140038367 AGGGAGAGGAAAGTGACTGTGGG + Intergenic
1198787455 X:140304241-140304263 AGTGAAAACACTGTGTCTGGTGG - Intergenic
1198947674 X:142032232-142032254 AGGGAGAATGCAGTGATTGTAGG - Intergenic
1199325091 X:146489933-146489955 AGGGAGAGTACAGTGACTGAGGG + Intergenic
1199457509 X:148045030-148045052 AGGGAGAGCACAGTGGTTGTGGG - Intergenic
1199464453 X:148120315-148120337 AGGGAGAGCAAAGTGATTGTGGG + Intergenic
1199685826 X:150264337-150264359 AGTGAGAACCCAGTGTCTGTGGG - Intergenic
1200177207 X:154125533-154125555 AGGGAGGGCACGGTGACTGTGGG + Intergenic
1200370089 X:155715867-155715889 AGGGCAAGCACAGCGACTGGGGG - Intergenic
1200542579 Y:4477755-4477777 AGAGAGAGCACAGTGACTGGCGG - Intergenic
1201066970 Y:10106251-10106273 AGGGAGGGCACAGTGACTGGAGG + Intergenic
1202080636 Y:21080624-21080646 TGAGAAAACACAGTGACAGTAGG + Intergenic