ID: 957542667

View in Genome Browser
Species Human (GRCh38)
Location 3:81593907-81593929
Sequence CTTTATCATCACCATGGAGT GGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 245
Summary {0: 1, 1: 0, 2: 1, 3: 14, 4: 229}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
957542667 Original CRISPR CTTTATCATCACCATGGAGT GGG (reversed) Exonic
901991222 1:13115623-13115645 CATTATCATCATCATCCAGTGGG + Intergenic
904103583 1:28055923-28055945 CTTTATCATCAACTTGGGATGGG + Intronic
905616581 1:39404970-39404992 TTTTGTCATCACCATGGTTTTGG + Intronic
905677787 1:39841245-39841267 CTTAATCATCTCAATGGAGATGG + Exonic
906537007 1:46556579-46556601 CTTTTTCATCTACCTGGAGTGGG - Intergenic
907766697 1:57420114-57420136 CCTTATCATCAACAGGGAGTGGG - Intronic
909953825 1:81753129-81753151 CTTTATCAGCAGCATGAAATTGG - Intronic
911530226 1:99035723-99035745 CTTTATCATCAGCATGAAAAAGG - Intergenic
911612015 1:99968347-99968369 CTTTATCAGCACCATGAAAATGG - Intergenic
913070124 1:115290903-115290925 CTTTAACATCATCATGCAGATGG - Intronic
915645431 1:157268629-157268651 CTTTCCCATCCCCATGGACTGGG - Intergenic
918633401 1:186746888-186746910 CTTTATCAGCAGCATGAAGATGG + Intergenic
919421313 1:197373543-197373565 CTTGATCATTACCTAGGAGTTGG + Intronic
921029393 1:211324573-211324595 CTTTATGATCAACAGGGAATTGG + Intergenic
921161841 1:212478413-212478435 ATTTAACATCACCACGGAGTGGG + Intergenic
921759664 1:218898314-218898336 CTTTATCATAACCAGGGATTTGG + Intergenic
922171978 1:223163202-223163224 CTTTCTCTTCCCCATGGAGATGG + Intergenic
922445990 1:225697807-225697829 CTTCCTCCTTACCATGGAGTTGG + Intergenic
923329534 1:232909705-232909727 ATTCATCATCAGAATGGAGTTGG + Intergenic
923461096 1:234210273-234210295 CTTTATCAGCAGCATGAAGATGG + Intronic
923952070 1:238967436-238967458 CTTATTCATCACCATGGAAGTGG + Intergenic
1062965070 10:1600837-1600859 ATTTAGCATCACCATGGAACAGG - Intronic
1065446377 10:25805806-25805828 CTTTATCAACAGCATGAAATCGG + Intergenic
1066040878 10:31547167-31547189 CTTTATCATCAGCATGAAAACGG - Intergenic
1066599012 10:37084098-37084120 CAATATCACAACCATGGAGTTGG + Intergenic
1067102458 10:43342994-43343016 GTTTATCGTCACCATGGAGACGG + Intergenic
1067205994 10:44214438-44214460 CTTTATCATCAGCATGAAAACGG + Intergenic
1067287621 10:44918344-44918366 CTTCCTCATCACCAAAGAGTGGG + Intronic
1067576656 10:47413038-47413060 CTTTATCAGCACCAAGGAAGAGG + Intergenic
1068184363 10:53565308-53565330 CTTTATCATCAGCATGGAAATGG + Intergenic
1070989365 10:80718138-80718160 CATTATCATCACCAAGTAGGGGG - Intergenic
1071277001 10:84064689-84064711 CTTTATCAGCACCATGAAAATGG - Intergenic
1073754590 10:106567490-106567512 GTTCATCATGATCATGGAGTAGG - Intergenic
1074287353 10:112110619-112110641 CTTTATCAGCAGCATGGAAATGG + Intergenic
1074733995 10:116408962-116408984 CTTACTCATTACCATGGAGATGG + Intergenic
1075165152 10:120061511-120061533 CATTCTCATCACCAGAGAGTAGG + Intergenic
1075177003 10:120174156-120174178 GTTTATCCTCACAATGAAGTAGG + Intergenic
1080934106 11:36843599-36843621 ATTTATCATCACTATTGAGGGGG + Intergenic
1081268660 11:41058056-41058078 TTTTATCCTCACCATTCAGTGGG - Intronic
1083049013 11:59760439-59760461 TTTTTTAATTACCATGGAGTGGG + Intronic
1083065353 11:59917856-59917878 CTTTATCAGCAGCATGAAATGGG - Intergenic
1084280604 11:68088490-68088512 CTTCATCATCAACAGGGACTTGG - Intronic
1084490702 11:69476671-69476693 TTTTATCATCACCCTTGATTCGG - Intergenic
1084798316 11:71524228-71524250 CTTATTCATCACCAAGGAGATGG - Intergenic
1085907006 11:80775446-80775468 CTTTATCAGCAGCATGGAAATGG + Intergenic
1086009972 11:82090321-82090343 CTTTATCTTCATCATGGAGGTGG + Intergenic
1087627342 11:100610301-100610323 CATTACCATCATCATGGTGTTGG - Intergenic
1089028323 11:115295185-115295207 CTCTATTGTCAACATGGAGTTGG - Intronic
1089855519 11:121540889-121540911 CTTTAGCATTACCACTGAGTGGG + Intronic
1097731514 12:63133613-63133635 GGTTATCATAACCAGGGAGTGGG - Intergenic
1099890973 12:88587880-88587902 CTCACTCATCACCAAGGAGTTGG + Intergenic
1104342695 12:127966437-127966459 CTTTATCAGCAGCATGGAAATGG - Intergenic
1106367242 13:29092921-29092943 TTTTATTATCATTATGGAGTGGG + Intronic
1107310448 13:39072390-39072412 CTGGTTCATCACCATGGAGAAGG - Intergenic
1109588126 13:64437086-64437108 CTTTAGTAACACCATGGAGGAGG - Intergenic
1109871946 13:68343641-68343663 CTTTATCATCAACATGAAAATGG - Intergenic
1109952084 13:69511991-69512013 CTTTATCAGCAGCATGGAAATGG + Intergenic
1110107617 13:71697386-71697408 CTTTATCATCATTATCAAGTTGG - Intronic
1110975330 13:81826253-81826275 CATTATCATCAATATGGATTTGG + Intergenic
1112736479 13:102425965-102425987 CATTATCATCACCATCAAGTAGG - Intergenic
1114282949 14:21211426-21211448 CATTATCATCATCATCCAGTAGG + Exonic
1116313047 14:43350689-43350711 CTCACTCATCACCATGGAGATGG + Intergenic
1118430271 14:65711863-65711885 CTTTCTAATAACCATGTAGTTGG + Intronic
1120022478 14:79546184-79546206 CTTTATCAGCACCATGAAAATGG + Intronic
1120316492 14:82900069-82900091 CTTTATCATGATAATGGAATAGG - Intergenic
1122756634 14:103985512-103985534 CTTTATCAGCAGCATGAAGATGG + Intronic
1123795481 15:23766282-23766304 CTTTATCAGCAACATGAAGACGG + Intergenic
1124148835 15:27158610-27158632 TTTTATCTTCACCATGGACCTGG + Intronic
1124889906 15:33723156-33723178 CTATAGTATCACCATGGGGTAGG + Intronic
1125618111 15:41034226-41034248 TTTTATCTTCACCATAGGGTGGG + Intronic
1126003848 15:44237816-44237838 CTTTATCAGCAGCATGGAAACGG - Intergenic
1127996498 15:64156022-64156044 CTTTGCCATCGCCAAGGAGTAGG - Exonic
1129096050 15:73209550-73209572 CTCTATCAGAATCATGGAGTAGG + Intronic
1129473400 15:75767316-75767338 CTTCATCATGATCAGGGAGTGGG + Intergenic
1129731630 15:77935715-77935737 CTTCATCATGATCAGGGAGTGGG + Intergenic
1129912176 15:79237083-79237105 CATTATCATCATCATCCAGTAGG - Intergenic
1132758362 16:1496790-1496812 CTTAATCGTCACGATGGTGTAGG - Intronic
1134144170 16:11746750-11746772 CTGTATCATCACCACAGAATGGG + Intergenic
1135981555 16:27151708-27151730 CCTTATCATCACCCTGAGGTGGG - Intergenic
1137736579 16:50728939-50728961 CTTTATCATCAGCATGAAAACGG - Intronic
1137841014 16:51640928-51640950 CTTTATCAACACCATGAAAACGG - Intergenic
1139522463 16:67492083-67492105 CTTTGCCAACACCAAGGAGTAGG - Intergenic
1140270098 16:73457815-73457837 CTGAGTCATCACCATGAAGTAGG - Intergenic
1140587472 16:76309951-76309973 CTTTATCAGCAGCATGGAAACGG + Intronic
1141037930 16:80644471-80644493 CTTTATCAGCAGCATGAAATTGG - Intronic
1141345075 16:83237257-83237279 CGTGAGCATCACCATGGGGTGGG - Intronic
1141709656 16:85690557-85690579 CTTTATCTTCAAAATGAAGTAGG + Intronic
1144062581 17:11597239-11597261 GTTTATCCTGACCATGGAGAAGG + Intergenic
1148603712 17:48912694-48912716 CTATATCCTCACCATGCAGAAGG - Intronic
1150600861 17:66649817-66649839 CTATTTCATCACCATGTACTTGG - Intronic
1154977828 18:21476138-21476160 GTTTGTCCTCACCATGTAGTGGG + Intronic
1155610621 18:27663435-27663457 CTTTATCAGCAGCATGAAGAAGG - Intergenic
1156928754 18:42615901-42615923 CTGTAGCATAACCTTGGAGTGGG + Intergenic
1166976537 19:46608240-46608262 CACTATCACCACCAAGGAGTTGG + Exonic
927062014 2:19432091-19432113 CTTTATCAGCAGCATGGAAATGG + Intergenic
927294198 2:21434707-21434729 CTTTATCAGCACCATGAAAGTGG + Intergenic
927556692 2:24039485-24039507 CTTTATCAAAAGGATGGAGTTGG - Exonic
934170629 2:89538349-89538371 CATGATCACCACGATGGAGTAGG - Intergenic
934280931 2:91612669-91612691 CATGATCACCACGATGGAGTAGG - Intergenic
934947427 2:98551913-98551935 ATTTATCATCACCGTTTAGTTGG + Intronic
935009969 2:99125103-99125125 TTTTATCATCTCCATATAGTTGG + Intronic
937713455 2:125005023-125005045 CTTTAACATCAAAATGAAGTTGG + Intergenic
938594930 2:132778921-132778943 CATAATCATCAGCATGGATTGGG - Intronic
939436530 2:142184341-142184363 CTTTATCAGCAGCATGGAAATGG - Intergenic
940462165 2:153978729-153978751 CTTTATCAGCAGCATGAAGATGG + Intronic
942219705 2:173757378-173757400 TTTTAACATCATCAGGGAGTGGG - Intergenic
943118750 2:183708035-183708057 CTTTATCAGCAGCATGAAGACGG + Intergenic
943601304 2:189924091-189924113 CATTATCATCATCATCCAGTAGG - Intronic
943764682 2:191648060-191648082 CATTGTCCTCACCATGTAGTGGG - Intergenic
944009993 2:194964086-194964108 CTTTATCAGCAGCATGGAAAAGG - Intergenic
944150714 2:196555210-196555232 ATTTATCATCATTATGGAGGCGG + Intronic
945038629 2:205726019-205726041 CATTGTCATCACCATGGAGCCGG - Exonic
945767818 2:214001869-214001891 CTTTATCATCAGCATGAAAACGG - Intronic
946968167 2:225061749-225061771 CTTTTTCAGCATCATTGAGTTGG - Intergenic
947906927 2:233771513-233771535 ATATATCATCACCTTGGATTTGG + Intronic
1170207753 20:13817685-13817707 CTTTTTTATCTCCATGGTGTGGG + Exonic
1170474900 20:16705240-16705262 CTTTATCAGCAGCATGAAGATGG + Intergenic
1170499472 20:16960222-16960244 CTTTATCAGCACCATGAAAACGG - Intergenic
1172018717 20:31897546-31897568 CTTTAACATCACCCCAGAGTGGG + Intronic
1174685871 20:52454567-52454589 CTTTATTATCACAAGGGAGATGG - Intergenic
1177002182 21:15627204-15627226 CATTATCATCACCATAGACTCGG + Intergenic
1177067839 21:16463205-16463227 CTTTATCATCAGCATGAAAATGG + Intergenic
1177177269 21:17713733-17713755 CTTTATCAGCACCACGGAAACGG - Intergenic
1177258327 21:18694048-18694070 CTTTATCAGCAGCATGAAATTGG - Intergenic
1178210366 21:30524193-30524215 TTTTATAGTCACCATGTAGTTGG + Intergenic
1180072901 21:45446014-45446036 CTTTTTCATAACCTTGGATTTGG - Intronic
1182863213 22:33579418-33579440 CTTTATCAGCACCATGAAAACGG + Intronic
953572170 3:44079714-44079736 CTTTATCATCTCCATGTCATAGG + Intergenic
954801405 3:53189141-53189163 CCTCATCATCACCATGGAAGGGG - Exonic
954887354 3:53887407-53887429 TTTTATAAACAACATGGAGTAGG + Intronic
955036911 3:55276973-55276995 CTTTATCAGCAGCATGAAATCGG - Intergenic
956584995 3:70854818-70854840 CCTTTTCCTCACCTTGGAGTTGG + Intergenic
957236165 3:77594897-77594919 CTTTAACTTAACCATGGATTTGG + Intronic
957542667 3:81593907-81593929 CTTTATCATCACCATGGAGTGGG - Exonic
957896164 3:86423870-86423892 CTTTATCAGCACCATGAAAACGG - Intergenic
958514869 3:95101170-95101192 CTTTATCATCAGCATGAAAATGG + Intergenic
958525101 3:95246923-95246945 CTTTATCAGCAGCATGAAGATGG + Intergenic
959054344 3:101552892-101552914 CTTTATCAGCAGCATGAAGATGG + Intergenic
959851693 3:111095906-111095928 CTTTATCAGCACCATGAAAATGG + Intronic
960224449 3:115152911-115152933 CTTTATCAGCAGCATGGAAACGG + Intergenic
961975551 3:131021035-131021057 CATTTTCATGACCGTGGAGTAGG + Intronic
962928347 3:140015348-140015370 CTGTATCATCATCATAGTGTTGG - Intronic
963267146 3:143250745-143250767 CTTTATCAGCAGCATGGAAATGG + Intergenic
964420602 3:156498613-156498635 CTTTATCAGCAGCATGAAGATGG + Intronic
964730346 3:159858055-159858077 CTGTTTCATAACCATGCAGTAGG + Intronic
965081883 3:164043827-164043849 CATTAATATCACCATGTAGTGGG - Intergenic
965259509 3:166463191-166463213 CTCTATCATAACCAGGGAATTGG - Intergenic
966512037 3:180775408-180775430 CTTTATCAGCAGCATGGAAATGG - Intronic
966576871 3:181511955-181511977 CTTTATCAGCAGCATGAAATCGG + Intergenic
967034050 3:185634471-185634493 CTTTATGATCACCATGAGGAGGG - Intergenic
969995562 4:11308753-11308775 CTTTATCATCAGCATGAAAACGG + Intergenic
970838394 4:20438244-20438266 CTTTATCAACACCATGAAAATGG - Intronic
972614806 4:40687645-40687667 TTTTATCATAACCAAAGAGTTGG - Intergenic
972849757 4:43034681-43034703 CTTTATCATCAGCATGAAAATGG + Intergenic
974149309 4:57985576-57985598 CTGTACCATAAACATGGAGTGGG - Intergenic
974772324 4:66432993-66433015 CTTTATCAGCAGCATGGAAACGG - Intergenic
975183793 4:71377838-71377860 CTTTATCAGCACCATGAAAATGG - Intronic
975923685 4:79423758-79423780 CTTTATCATCAGCATGAAAATGG - Intergenic
978267565 4:106844621-106844643 CTTTATCATCAGCATGAAAATGG - Intergenic
978400559 4:108325905-108325927 CTCTATCATCACCCTGGTCTTGG + Intergenic
978601060 4:110428539-110428561 CTTATTCATCACCATCAAGTCGG - Intronic
978920146 4:114174364-114174386 CTTTATCAGCACCATGAAAACGG - Intergenic
979327711 4:119399111-119399133 CTTTATCAGCAGCATGGAAATGG - Intergenic
979863667 4:125725662-125725684 CTTTCTCATCACCTGGGACTGGG + Intergenic
980609424 4:135138313-135138335 CATTATTATCCACATGGAGTTGG - Intergenic
980751389 4:137094554-137094576 CTATTACATCTCCATGGAGTAGG - Intergenic
980801825 4:137761518-137761540 CTTTAACATGACCTTGGTGTTGG - Intergenic
982635545 4:157891945-157891967 CTTTATCATAATTAGGGAGTTGG + Intergenic
982886536 4:160789018-160789040 CTTTATCAGCAACATGGAAATGG + Intergenic
983245462 4:165282833-165282855 CTTTATCAGCAGCATGGAAATGG - Intronic
986251579 5:6062969-6062991 CTTTATCAGCAGCATGGAAAAGG + Intergenic
987386471 5:17334400-17334422 CTTTATCAGCACCATGGAAACGG - Intergenic
988898113 5:35700209-35700231 CTTTATCAGCAGCATGGAAAGGG + Intronic
988924722 5:35978335-35978357 CTTTATCAGCACCATGAAAATGG - Intronic
990174245 5:53089535-53089557 CTGTTTCATCACCATGAAGTTGG + Intronic
990488490 5:56281567-56281589 CTTTATCAGCAGCATGGAAAGGG - Intergenic
990631917 5:57679740-57679762 CGTCATCATCACCATGCATTAGG - Intergenic
990800459 5:59596460-59596482 GATTATCATCAGCATGTAGTGGG + Intronic
991532845 5:67634779-67634801 CTTTATCAGCACCATGAAAATGG + Intergenic
992873374 5:81028013-81028035 CTGCAACATCACCATGGAGTGGG + Intronic
993373497 5:87120246-87120268 CTTTATCAGCACCATGAAAATGG + Intergenic
994847455 5:105008115-105008137 CTTTATCAGCACCATGAAAGTGG - Intergenic
996222971 5:120954882-120954904 CTTTATCATCAGCATGAAAATGG + Intergenic
998478004 5:142437556-142437578 CTATATCATCCCCATTGTGTTGG + Intergenic
1002326099 5:178407330-178407352 CTTTATCATCAGCATGGTGTCGG + Intronic
1004609328 6:17224423-17224445 CTTTATCAGCAGCATGGAAATGG - Intergenic
1006763142 6:36481401-36481423 CTTAATTATCACCCTGGAGCAGG + Intronic
1007185802 6:39971387-39971409 CTTTATCAGCAGCATGAAATGGG + Intergenic
1007273451 6:40656100-40656122 CCTTATCTCCACCATGGAATGGG - Intergenic
1008449692 6:51635987-51636009 CACTATCATTACCATGGTGTAGG - Intronic
1008579586 6:52894844-52894866 CTTCATCTACACCATGCAGTGGG + Intronic
1010075507 6:71792519-71792541 CTTCAGCATCATCATGGGGTAGG + Intergenic
1010928914 6:81777082-81777104 CTTTATCAACAGCATGGAAATGG - Intergenic
1012161164 6:95887701-95887723 CTTTATCAGCACCATGAAAATGG - Intergenic
1013470785 6:110461892-110461914 CTTTATCAGCAGCATGAAATTGG - Intronic
1013794819 6:113875325-113875347 TTATATCATTTCCATGGAGTTGG + Intergenic
1014147529 6:118015222-118015244 CTTTATCAGCAGCATGAAGATGG + Intronic
1014488791 6:122036158-122036180 CTTTATCAGCAGCATGAAGATGG + Intergenic
1014952796 6:127578075-127578097 CTGTGTCATCAGCAGGGAGTGGG - Intronic
1015516752 6:134090090-134090112 CTTTATCAGCACCATGAAAATGG - Intergenic
1017210936 6:151855277-151855299 TATTATAATCACCATGGAGATGG + Intronic
1018608757 6:165625840-165625862 CTTTATCAACAGCATGGAAACGG + Intronic
1020872522 7:13649855-13649877 CTTTTTCCTCATCATGGGGTAGG - Intergenic
1021107408 7:16653788-16653810 TATTATCATCTCCATGGAGTGGG + Intronic
1021301565 7:18979831-18979853 CTTACTTATCACCATGGAGATGG + Intronic
1022263973 7:28735495-28735517 CTTTATCATTATCATTGGGTGGG + Intronic
1023501935 7:40860081-40860103 CTCGCTCATCACCATGCAGTGGG - Intronic
1023509732 7:40939043-40939065 CTTTATCAGCAGCATGGAAATGG - Intergenic
1026200934 7:68214035-68214057 CTCTCTCATCACCATGGGGAGGG + Intergenic
1027625922 7:80544841-80544863 CTTTATCAGCACCATGAAAATGG + Intronic
1027687650 7:81296836-81296858 CTTTATCAGCAGCATGAAGATGG + Intergenic
1027979519 7:85200111-85200133 CTTTATCAGCAGCATGGAAGTGG + Intergenic
1028790051 7:94843701-94843723 CTTTATCAGCAGCATGAAGATGG + Intergenic
1029788544 7:102818381-102818403 CTTTATCATCAAAATGGATAAGG - Intronic
1031889014 7:127272838-127272860 CTTTGTTGTCACCATGTAGTTGG - Intergenic
1033430282 7:141282843-141282865 CTTTTTCATCCCAATGCAGTTGG - Intronic
1033499620 7:141934844-141934866 CTTTTTCATCACCAAGGAAAAGG + Intronic
1033760108 7:144428410-144428432 CTTTATCAGCAGCATGAAGACGG - Intergenic
1034395336 7:150819968-150819990 CTTTATCCTGATCATGGTGTTGG + Intergenic
1036461671 8:8959140-8959162 CTTTATCAGCACCATGAAAATGG - Intergenic
1039073440 8:33667034-33667056 CTTTATCAGCAGCATGAAGATGG - Intergenic
1042477704 8:69267540-69267562 CATTATCATCTACATGAAGTCGG + Intergenic
1042670157 8:71253315-71253337 CTTTATCTTCTTCCTGGAGTGGG - Intronic
1043760110 8:84057688-84057710 CTTTATCAGCACCATGAAAATGG + Intergenic
1045438699 8:102189169-102189191 CATCAGCATCACCGTGGAGTTGG - Intergenic
1045706225 8:104926227-104926249 CTTTATCAGCAGCATGAAATTGG + Intronic
1047872861 8:129104371-129104393 CTTCATGATCAAGATGGAGTTGG + Intergenic
1048741742 8:137568333-137568355 CTCTATCATCACCATGGGGAAGG + Intergenic
1048822162 8:138390516-138390538 CTTTATCAGCACCATGAAAAGGG + Intronic
1049180198 8:141218290-141218312 CTTGATCAGCACCACGGCGTTGG + Exonic
1049384150 8:142332642-142332664 GTTTATCCTCACCATGCAGCGGG - Intronic
1052397281 9:27954693-27954715 CTTTATCATCAGCATGAAAATGG - Intronic
1056087221 9:83162013-83162035 CTTTATCAACAGCATGGAAATGG + Intergenic
1056705799 9:88952010-88952032 CTTCATGATGACCATGAAGTTGG - Intergenic
1058127380 9:101210673-101210695 CTTTATCTTTACCATGGAAGTGG + Intronic
1186558846 X:10589379-10589401 CTTTATCAGCACTTTGGTGTTGG - Intronic
1188449453 X:30294160-30294182 CTTTATCAGCACCATGAAAACGG + Intergenic
1190036039 X:47024811-47024833 CTACATCAACATCATGGAGTTGG + Exonic
1191021832 X:55868550-55868572 CTTTTTAATCACCTGGGAGTAGG - Intergenic
1195109362 X:101630088-101630110 CTTTATCCTCACAGTGGAGATGG - Intergenic
1195653457 X:107311760-107311782 GTTTATCATCACCATAGATAAGG - Intergenic
1195914596 X:109923808-109923830 CTGTGTCATCACCATGCACTAGG - Intergenic
1196549020 X:116998981-116999003 CTTTATCATCAGCATGAAAATGG + Intergenic
1198919201 X:141707281-141707303 CTTTATCAGCAGCATGAAGATGG - Intergenic
1199009573 X:142743280-142743302 CTTTATCAGCAACATGGAAACGG - Intergenic