ID: 957543349

View in Genome Browser
Species Human (GRCh38)
Location 3:81604745-81604767
Sequence CATGAAAATACCACTTTTGT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 346
Summary {0: 1, 1: 0, 2: 2, 3: 32, 4: 311}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
957543349 Original CRISPR CATGAAAATACCACTTTTGT AGG (reversed) Intronic
902059730 1:13632015-13632037 TATGAAATTGCCATTTTTGTAGG + Intergenic
905163772 1:36063424-36063446 GATTAAGATACCATTTTTGTAGG + Exonic
905917128 1:41693022-41693044 CATAATAATACCACTTTCATAGG - Intronic
906350129 1:45051813-45051835 CATAAAAATACCTACTTTGTAGG + Intronic
906368298 1:45230232-45230254 CATTAATATACAACATTTGTTGG - Intronic
907998915 1:59661253-59661275 CATTAAAAAAGCACTTCTGTTGG - Intronic
908555498 1:65253574-65253596 TATGAAATTGCCATTTTTGTAGG - Intronic
908975857 1:69897484-69897506 CATGGAAATACCATTATTGTGGG - Intronic
909252176 1:73372100-73372122 CATAAAATTGCCAATTTTGTAGG - Intergenic
909260165 1:73478021-73478043 CAAGAAAATACCACTTCTATTGG + Intergenic
909296067 1:73950434-73950456 CATGAAAAAGACATTTTTGTAGG - Intergenic
909572491 1:77132159-77132181 CATGTAAATAGCACATTTTTAGG + Intronic
909746410 1:79103454-79103476 CATGTATATCCCACTTTAGTGGG + Intergenic
912173815 1:107133835-107133857 TATGAAATTGCCATTTTTGTAGG + Intergenic
912747764 1:112259717-112259739 CATCAAAAGGCCACCTTTGTAGG + Intergenic
914861166 1:151387426-151387448 ACTGAAAATACAACTCTTGTAGG + Intergenic
916147999 1:161758796-161758818 CATGAAGTTACCCCTTTTGTAGG + Intergenic
916627320 1:166572219-166572241 CAAGATAATACCAATGTTGTTGG + Intergenic
920020709 1:202954386-202954408 TCTGAAAATACCACTTCTATGGG + Intronic
920591921 1:207228412-207228434 CCTCAAAATATCACTTTGGTTGG + Intergenic
921498906 1:215876262-215876284 TATGAAACTGCCACTTTTATAGG - Intronic
923117650 1:230958417-230958439 CAAGAAAATGCCACTATTGTGGG + Intronic
923151609 1:231238466-231238488 CATGAAAATAGGACTTTCTTGGG - Intronic
923487905 1:234453583-234453605 CATGAAAATGCCATTTCTATAGG + Intronic
1063089939 10:2855084-2855106 CATAAATATACCACATTTATTGG + Intergenic
1063815491 10:9767077-9767099 TATGAAAATACAACATTTGTTGG - Intergenic
1064745100 10:18470941-18470963 CATAAAATTAACACTGTTGTTGG - Intronic
1065477461 10:26155847-26155869 CATTATCATACCACTGTTGTTGG + Intronic
1065878941 10:30022978-30023000 AAAGAAAGGACCACTTTTGTAGG - Intronic
1066123474 10:32315098-32315120 CATGAGAATACATCTTTTGAAGG - Intronic
1066413296 10:35194430-35194452 CATGAAACTGCTATTTTTGTAGG + Intronic
1067484083 10:46629667-46629689 GATAAAAATACCAATTTTGAAGG - Intergenic
1067610676 10:47711977-47711999 GATAAAAATACCAATTTTGAAGG + Intergenic
1068900767 10:62267722-62267744 TATGAAATTGCCAGTTTTGTAGG - Intronic
1069117040 10:64520478-64520500 ATTGAAAATACGACATTTGTGGG + Intergenic
1071760954 10:88605861-88605883 CATGGAAAAGCCACTTTGGTTGG - Intronic
1071808490 10:89151480-89151502 CATAAAATTACTGCTTTTGTAGG - Intergenic
1073560499 10:104492391-104492413 CATGAAAATAGCTTTTTTATAGG - Intergenic
1074166445 10:110881120-110881142 CATGACATTACCATTTTTGTAGG - Intronic
1074720253 10:116257720-116257742 CATGAAATTGCCATTTTAGTAGG - Intronic
1074940887 10:118235136-118235158 GATGGAAATTCCACTTTTTTTGG + Intergenic
1074958074 10:118411974-118411996 CTTGAAAATTCCACTCCTGTTGG + Intergenic
1075136649 10:119792498-119792520 AAAGAAAATACCTCTTTTGCAGG - Intronic
1076260597 10:129061778-129061800 AATGCAAATTCCAATTTTGTGGG - Intergenic
1076501776 10:130942953-130942975 CATGAAAAATCCTCTTTTGTGGG + Intergenic
1080115655 11:28618824-28618846 CAGGAAAATGCCTCTTTTCTGGG + Intergenic
1080172777 11:29325874-29325896 CATGAAATTGCCATTTCTGTAGG + Intergenic
1081412133 11:42772413-42772435 CAAGAAAGAATCACTTTTGTAGG - Intergenic
1082224040 11:49679841-49679863 CATGAAAATACGATTAATGTGGG + Intergenic
1082582516 11:54890288-54890310 TTTGAAAACACCATTTTTGTAGG + Intergenic
1083007788 11:59364726-59364748 CAGCAAACTATCACTTTTGTTGG + Exonic
1087297653 11:96396287-96396309 CATGAAAATATTATTTTTGAAGG - Intronic
1087847041 11:102985036-102985058 CGTGAAATTGCCATTTTTGTAGG + Intergenic
1088672353 11:112154701-112154723 CATGAAAATCCCAGTTTTCATGG - Intronic
1088678712 11:112221217-112221239 GATGAAAATTCCCTTTTTGTGGG + Intronic
1088978440 11:114837508-114837530 GATGAAATTGCCACTTTTATAGG + Intergenic
1090888602 11:130901857-130901879 AATGGAAAAACCACTTTTGTAGG + Intronic
1091181665 11:133610101-133610123 CATGAAAGTCTCACTGTTGTAGG - Intergenic
1091643818 12:2257910-2257932 TATGAAAATGCCGCTTCTGTAGG - Intronic
1092658292 12:10710839-10710861 CATGAAAATAACAGTTTTTATGG - Intronic
1093264596 12:16988213-16988235 CACTCAAATACCACTTTTGCAGG - Intergenic
1093639739 12:21512401-21512423 CATCAAAATACGTATTTTGTTGG - Intronic
1093784108 12:23173005-23173027 CTTGAATGTCCCACTTTTGTTGG - Intergenic
1094099600 12:26747423-26747445 TTTAAAACTACCACTTTTGTAGG + Intronic
1094392702 12:29969812-29969834 CCTGAAAATACTACTTCTGAGGG - Intergenic
1094696705 12:32826431-32826453 CATGAAATTGCCATTTTTGAGGG - Intronic
1094775402 12:33721096-33721118 AAAGAAAATACCACTGTTATAGG - Intergenic
1095301532 12:40590126-40590148 CTTGAAAATGGCACATTTGTGGG - Intergenic
1097475814 12:60054475-60054497 CATAAAATTACTACTTTTCTTGG + Intergenic
1099340501 12:81426009-81426031 CTTTAAAATAACACTTTTATTGG - Intronic
1099465820 12:82986785-82986807 TATGAAATTACCATTTTTATAGG - Intronic
1099493700 12:83318250-83318272 CTTGAAAATACCTTTTTTTTTGG + Intergenic
1100249363 12:92800401-92800423 CATGAAAACATGACTTTGGTTGG - Intronic
1100351351 12:93786378-93786400 AATGATAATACCTCTTTTGTAGG + Intronic
1100408168 12:94289046-94289068 TATGAAACTACCACTTTTGTAGG - Intronic
1100546819 12:95611306-95611328 CTTGAAAATAACAATTTTGGGGG - Intergenic
1100920361 12:99477586-99477608 CATGATAATATCATGTTTGTGGG + Intronic
1102471187 12:113160839-113160861 CATGCAAATGCCATTTTTGCAGG + Intronic
1105350068 13:19606974-19606996 CATCCAAAGACCACTTTTTTGGG + Intergenic
1106229999 13:27814372-27814394 CATGGAAATACCACTCTAGCTGG + Intergenic
1108531841 13:51334543-51334565 CATGATAATCCCATTTTAGTTGG + Intergenic
1109520917 13:63509430-63509452 TATGAAGATACCAGTTCTGTTGG + Intergenic
1111193920 13:84846847-84846869 CATGAAAATTACACTATTATAGG + Intergenic
1112703090 13:102034601-102034623 CATTAAAATAGCTCTTATGTTGG - Intronic
1113298740 13:108992179-108992201 CATTAAAATAACAGTTTTGGGGG + Intronic
1113711976 13:112471431-112471453 AACCAAAATACCAATTTTGTTGG + Intergenic
1114737138 14:25053529-25053551 TATGAAACTGCCATTTTTGTTGG + Intergenic
1115332986 14:32217999-32218021 CATAAAAATAACTATTTTGTGGG - Intergenic
1115387415 14:32813668-32813690 AATCAAAATAGCACTTATGTGGG + Intronic
1116388351 14:44360164-44360186 TATGAAATTTCCATTTTTGTAGG - Intergenic
1117043572 14:51790355-51790377 CCTGAAATTGCCATTTTTGTAGG - Intergenic
1117069413 14:52043236-52043258 CATGAAACCACTATTTTTGTGGG + Intronic
1117814001 14:59578342-59578364 CCTGAAACTACCACTTCTGGAGG - Intergenic
1119041637 14:71279771-71279793 CATAGAAATACCACTTTCCTTGG + Intergenic
1121128371 14:91423246-91423268 TATGAAATTGCCATTTTTGTAGG - Intergenic
1121189818 14:92016721-92016743 CATGATAATACCTATCTTGTAGG - Intronic
1123973990 15:25535485-25535507 CAAGAAGAAACCTCTTTTGTTGG + Intergenic
1125430709 15:39590354-39590376 CAAGAAAATAAAACTTTTCTTGG - Intronic
1128098655 15:64979332-64979354 CATGACACTACCATTTTTGGTGG - Intronic
1128439515 15:67691646-67691668 CAAGAGCATACCACTTTTGATGG - Intronic
1129258704 15:74350294-74350316 ATTTAAAATACAACTTTTGTGGG - Intronic
1129623095 15:77167681-77167703 CATGAAAAGACAACTTTGATAGG + Intronic
1130854123 15:87825942-87825964 TATGAAAGTCCCATTTTTGTAGG - Intergenic
1132216417 15:100065024-100065046 CATGGAAATACCTATTTTGAGGG + Intronic
1133397851 16:5462604-5462626 CCTAAAAATACCACATTTTTAGG - Intergenic
1133842033 16:9418604-9418626 CATGAAAAAAACACATTTGAGGG - Intergenic
1134061545 16:11202484-11202506 CATGAGATTGCCATTTTTGTGGG - Intergenic
1135088863 16:19496381-19496403 AACGCAAATACCACTTATGTTGG + Intronic
1135753810 16:25079807-25079829 CCAGAAACTACCTCTTTTGTGGG - Intergenic
1137575730 16:49598887-49598909 CATGAAAATGTCATTTTGGTAGG + Intronic
1137949908 16:52773879-52773901 CATGAATATACCCTATTTGTAGG - Intergenic
1138198724 16:55073557-55073579 AATGAACATACCACTTTTAGGGG + Intergenic
1138298740 16:55909091-55909113 AATGAAAATTGCCCTTTTGTGGG - Intronic
1138346765 16:56324909-56324931 CATGTAAATAGCACTTTAGCTGG + Intronic
1139321568 16:66118510-66118532 CATGAAATTTCCACTTCTATTGG - Intergenic
1140302339 16:73770482-73770504 AATGAAAACACCACATTTCTAGG + Intergenic
1141918307 16:87116789-87116811 CATGAAATTTCCATTTTTGTAGG - Intronic
1142825023 17:2505304-2505326 CAAGAAATCACCACTTCTGTAGG + Intronic
1143791984 17:9304618-9304640 CATGAAATTACCATTTGTGTAGG - Intronic
1145112241 17:20174185-20174207 CATGTAAACAGCACTTTTGGAGG - Intronic
1148447515 17:47746539-47746561 TGTGAAATTACCATTTTTGTAGG + Intergenic
1150477385 17:65485443-65485465 CATGATAATGCCAGTCTTGTAGG - Intergenic
1156037251 18:32778845-32778867 AATGAAAGTACCACTATTTTTGG + Intergenic
1157094806 18:44678716-44678738 CCTGAAAAGACCCCCTTTGTAGG + Intergenic
1158055975 18:53280842-53280864 TATGAAATTACCATTTTTGTAGG + Intronic
1158204134 18:54972878-54972900 CATGACAACAACAGTTTTGTTGG - Intergenic
1159535556 18:69710346-69710368 CATGAGAATACCTATTTTGTAGG - Intronic
1164502884 19:28834096-28834118 CATGAAACTCTCCCTTTTGTGGG + Intergenic
1165594641 19:37002277-37002299 CAGGAAAATAATACTTTTCTAGG - Intergenic
1165921768 19:39303400-39303422 CATGAACTTGCCATTTTTGTAGG - Intergenic
927345324 2:22031886-22031908 GAAGAAAATACCTCTCTTGTGGG + Intergenic
929346102 2:40886806-40886828 CATGCAAATATGAGTTTTGTTGG - Intergenic
929606624 2:43239061-43239083 CATGTTAATCCCACTTGTGTAGG - Intronic
929992409 2:46801256-46801278 CATGGAACTGACACTTTTGTGGG - Intergenic
930298390 2:49583919-49583941 CCTAAAAATATCACTTCTGTTGG + Intergenic
930419066 2:51127441-51127463 CATGGAAATACAATTTTTGGTGG - Intergenic
931585032 2:63816750-63816772 TATGAATATACCACATTTTTAGG - Intronic
932277800 2:70464416-70464438 TATGAAATTGCCATTTTTGTAGG - Intronic
932859880 2:75279089-75279111 CATGAAATTGCCACTTTCGAAGG - Intergenic
933237656 2:79882876-79882898 CATGAAAAAAGCAGTTTTGCCGG + Intronic
934579240 2:95425432-95425454 CATGAAGATTCCACTTTTCCTGG + Intergenic
934600206 2:95651292-95651314 CATGAAGATTCCACTTTTCCTGG - Intergenic
934977336 2:98812309-98812331 CATGAACGTATGACTTTTGTGGG + Intronic
935341137 2:102060899-102060921 GATGAAAACACCTCTTTTGAGGG + Intergenic
938990960 2:136629387-136629409 AAAGAAAATGTCACTTTTGTGGG + Intergenic
939681947 2:145147098-145147120 CATTAAAATATGACTTCTGTAGG + Intergenic
940109876 2:150139933-150139955 CATGCAAATGCAACTGTTGTGGG + Intergenic
940243051 2:151584082-151584104 CATGAAACTACCATGTTTTTCGG + Intronic
940244006 2:151594634-151594656 CATGAAACTACCATGTTTTTCGG + Intronic
940244965 2:151605187-151605209 CATGAAACTACCATGTTTTTCGG + Intronic
940342882 2:152600005-152600027 CCTGACAAAACCACTTTTCTGGG - Intronic
940736385 2:157457502-157457524 CATGAAAAAGCCACTCTTCTAGG - Intronic
941043297 2:160647297-160647319 CATGAACAAACCACCTATGTTGG - Intergenic
941890296 2:170573567-170573589 CATACAAATGCCACTTTAGTTGG + Intronic
942991272 2:182206354-182206376 AACAAAAATACCACTCTTGTTGG - Intronic
943362329 2:186935090-186935112 CATGAAAATACCACAATTTCAGG + Intergenic
943550094 2:189327809-189327831 CATGAACATTCCAATTATGTAGG - Intergenic
943897802 2:193389306-193389328 AATAAAAATTACACTTTTGTTGG + Intergenic
944208506 2:197182750-197182772 GATGAAAATACAACATTCGTGGG - Intronic
944454887 2:199883196-199883218 CATGATATTACATCTTTTGTTGG + Intergenic
945465019 2:210159131-210159153 CCTGATAATACCAATTTTGTAGG - Intronic
947384094 2:229573179-229573201 CAAGCAAATATAACTTTTGTAGG + Intronic
948876286 2:240831511-240831533 TTTAAAATTACCACTTTTGTAGG - Intergenic
1169700216 20:8437734-8437756 TATAAAAATACCACTTTTACTGG + Intronic
1170750412 20:19139931-19139953 AAAGAAAATACCATTTTTCTGGG - Intergenic
1174020213 20:47523909-47523931 TATGAAAATACCACACTTGTGGG - Intronic
1176892893 21:14339844-14339866 TATGAAATTGCCATTTTTGTGGG - Intergenic
1176905737 21:14498306-14498328 TATGAAAATACCTATTTTATGGG + Intronic
1177053407 21:16268028-16268050 AATGAAAATAACACTTTCCTTGG - Intergenic
1177864415 21:26495885-26495907 CCTGGAAATACCACGTTAGTAGG + Intronic
1178123961 21:29497573-29497595 TATGAAAATAGGTCTTTTGTAGG - Intronic
1179137030 21:38688506-38688528 CATGAAACTGCCATGTTTGTAGG - Intergenic
1180731337 22:17984660-17984682 CATGAAGCTTCCATTTTTGTGGG + Intronic
1182236380 22:28880219-28880241 CATGAAAATACCACTAAAGATGG + Intergenic
1182645506 22:31805795-31805817 CCTGAAATTGCTACTTTTGTAGG - Intronic
1183774244 22:39952789-39952811 CATAAGAATACCACATTTGATGG + Intronic
1184114213 22:42412878-42412900 CATGACAAAGCCAGTTTTGTAGG + Intronic
949103370 3:173631-173653 TATGTATATACTACTTTTGTGGG + Intergenic
949237874 3:1832399-1832421 GATGAAAATACCAATTTAGGAGG - Intergenic
949619859 3:5798359-5798381 CATGAAAATGCAAATTTTGGGGG + Intergenic
950214739 3:11151481-11151503 CATGAAAATTCCTTTTTTGGGGG + Intronic
952291480 3:32021061-32021083 CATTAAAACACCAGTTCTGTTGG + Intronic
952332512 3:32377252-32377274 TATGAAATTGCCATTTTTGTAGG - Intergenic
952498982 3:33941723-33941745 CATGAAACTGCCATTTTTGTAGG - Intergenic
953271701 3:41451777-41451799 AATGAAACTGCTACTTTTGTAGG + Intronic
953513282 3:43565616-43565638 CAGAAAAATACCAATTTTTTAGG - Intronic
953763195 3:45710725-45710747 CATGAAATAACCATTTTTATTGG - Intronic
953819608 3:46194038-46194060 CATTAAAAAACCACTGCTGTAGG - Intronic
954694256 3:52412130-52412152 CATGAAAGTGCCACTTTCCTAGG - Intronic
954867464 3:53742141-53742163 TATGAAATTGCCATTTTTGTAGG + Intronic
955741569 3:62096269-62096291 CATGAAAATAACGCTTCTGGAGG + Intronic
956074002 3:65485280-65485302 CATGAACATCCTATTTTTGTAGG - Intronic
956508283 3:69966470-69966492 CATGAAAATAGCAATATTCTTGG + Exonic
957543349 3:81604745-81604767 CATGAAAATACCACTTTTGTAGG - Intronic
958547872 3:95578731-95578753 CATGAAAATGCCAATTTTTAAGG - Intergenic
959363185 3:105421448-105421470 CTTTAAATTACCAATTTTGTTGG - Intronic
959536673 3:107493981-107494003 CATAAAAGTGCCATTTTTGTAGG + Intergenic
961096764 3:124163559-124163581 CATGAAAATACATGTTTTGCTGG + Intronic
962050203 3:131805652-131805674 CATGAAGAAACCATTTTTATAGG - Intronic
962893156 3:139690672-139690694 CATAAAAATCCCAACTTTGTAGG + Intergenic
963586616 3:147199176-147199198 CACAAAATTAACACTTTTGTTGG + Intergenic
964179123 3:153863051-153863073 CATGCAAATAAGACTTTTGGAGG - Intergenic
964353303 3:155824460-155824482 CATGAAGATTTCTCTTTTGTAGG + Exonic
965254046 3:166381123-166381145 TATGAAACTTCCACTTTTATAGG - Intergenic
965601571 3:170459476-170459498 CATGAAAGTTCCACTTTAGTGGG - Intronic
965678441 3:171224537-171224559 AATGAGAGTACCACTTTTCTAGG - Intronic
966003962 3:174985601-174985623 CAATATAATACCACTTTTGATGG - Intronic
966059859 3:175741619-175741641 CATGAAAATATAACTTTTTTGGG + Intronic
966473778 3:180321662-180321684 CATGACTATAACACTTTTCTGGG - Intergenic
966569113 3:181421239-181421261 TATAAAATTACCATTTTTGTAGG - Intergenic
968001228 3:195208166-195208188 CATCCAAATACCACCTCTGTTGG - Intronic
969842496 4:9892614-9892636 AATGATAATACCATTTTTGCAGG + Intronic
971011048 4:22435617-22435639 CATTAAAATTCCAGTTTTCTTGG - Intronic
971151967 4:24043042-24043064 CAGGAAGCTACCAATTTTGTAGG + Intergenic
973143699 4:46798767-46798789 CATGTATATATCACTTCTGTTGG - Intronic
974714081 4:65643738-65643760 CATGAAAGTTTCATTTTTGTGGG - Intronic
975356486 4:73411958-73411980 CATGATAATACCATTTTGATTGG + Intronic
976361559 4:84184667-84184689 CATAACAATACAACTTTTTTGGG - Intergenic
977666005 4:99648415-99648437 CATGAAAATAACAGTCTTGTGGG + Intronic
978223639 4:106307597-106307619 CATAAAATTGCCACTTTTATAGG + Intronic
978415640 4:108473061-108473083 CATAAATATACCACTCTTGTGGG + Intergenic
978668138 4:111211526-111211548 CCTAAAAATACCACTTTATTAGG + Intergenic
979372027 4:119900509-119900531 TAGGAAAAAACCTCTTTTGTTGG + Intergenic
980335919 4:131473176-131473198 CTTGAAATTATCACTTTTGGTGG - Intergenic
981146423 4:141330630-141330652 CATGAAATTGCCATTTTTGTAGG + Intergenic
982150057 4:152444141-152444163 TATGAAATTACCGTTTTTGTAGG - Intronic
982522417 4:156435515-156435537 ACTGAAAATATCACTTTTTTAGG - Intergenic
984237374 4:177176347-177176369 TATGAATATACCACATTTTTAGG - Intergenic
985912982 5:2897502-2897524 CAGGAAAATCCCACTGTTGCTGG - Intergenic
988256038 5:28821508-28821530 AATGATAATAGCACTTTTGAAGG - Intergenic
989303626 5:39925561-39925583 AATGAAAAGACAACTTTTGTAGG - Intergenic
989710517 5:44390816-44390838 TATGAAATTACCACTTTTGTAGG - Intergenic
990400959 5:55436895-55436917 TAGGAAAATAGGACTTTTGTGGG + Intronic
991267913 5:64744573-64744595 TATGAAATTGCCATTTTTGTAGG + Intronic
991283940 5:64948344-64948366 TATGAAATTGCCATTTTTGTAGG + Intronic
991320598 5:65369395-65369417 TATGAAATTGCCACTTTTGTAGG - Intronic
992101643 5:73413533-73413555 TATGAAACTGCCACTTTTGTAGG + Intergenic
994258890 5:97633618-97633640 CATTAAAATATGACTTCTGTAGG + Intergenic
994643471 5:102440020-102440042 AATGAAAATATGACTTTTGCTGG + Intronic
995589836 5:113687843-113687865 CATGAAATGACCATTTTTATAGG + Intergenic
996028841 5:118682899-118682921 CAAGAAAATATCATGTTTGTTGG + Intergenic
996805363 5:127448191-127448213 CATGAAATTGCTATTTTTGTAGG + Intronic
999335345 5:150711320-150711342 GATGAAAATACCCACTTTGTTGG + Exonic
1003123919 6:3340106-3340128 CTGGATAATACCGCTTTTGTGGG - Intronic
1003830432 6:10004067-10004089 CATGAAATTGACATTTTTGTAGG + Intronic
1004538609 6:16527237-16527259 CAGGAAAATCTCACTTTTGAGGG + Intronic
1005422721 6:25669388-25669410 AATGGAAATTCCACTTTTGATGG - Intronic
1006806418 6:36792431-36792453 CATCCAAAGACCACTTCTGTGGG + Intronic
1008918526 6:56817444-56817466 TATGAAAATAAAACTTTTGATGG + Intronic
1009277785 6:61705944-61705966 CATGAAAATCACATTTTAGTAGG - Intronic
1009862438 6:69351782-69351804 TATGGAAATACAATTTTTGTAGG - Intronic
1010493336 6:76501172-76501194 GCTGAAAATACCTCATTTGTGGG + Intergenic
1010881856 6:81185762-81185784 CATGAAAATAACACTGAGGTTGG - Intergenic
1011031517 6:82929296-82929318 CATGGAACTAAGACTTTTGTGGG + Intronic
1011772036 6:90683921-90683943 CATGTAAATTCCCTTTTTGTGGG + Intergenic
1012324157 6:97893846-97893868 CAATAAAATATCATTTTTGTAGG + Intergenic
1012627349 6:101420436-101420458 CATGAAATGACCATTTTTCTTGG - Intronic
1012835431 6:104259008-104259030 TATGAAAATACAACTTTTAATGG - Intergenic
1012958393 6:105595338-105595360 CTTCAAAATACACCTTTTGTGGG - Intergenic
1013336065 6:109163718-109163740 AAAAAAAATACCACTTTTGTGGG - Exonic
1013384377 6:109610602-109610624 CATGAAAATAATACTTTCTTGGG - Intronic
1013566069 6:111364229-111364251 ACTGAAAATAACAGTTTTGTAGG + Intronic
1013642267 6:112096906-112096928 GATGAAAATACTAATATTGTAGG + Intronic
1013778482 6:113704627-113704649 CATGAAAATAACAATTTTAGGGG + Intergenic
1014361143 6:120475970-120475992 CAACAAAAAACCACTTTTATGGG - Intergenic
1015082033 6:129238378-129238400 CATGAAAATACCTACTTTGAAGG - Intronic
1015387858 6:132646344-132646366 TATGAAACTGCCACATTTGTAGG + Intergenic
1015446790 6:133315431-133315453 CATTAAAATTACAATTTTGTGGG + Intronic
1017720956 6:157242807-157242829 TATGAAATTGCCACTTTTATAGG - Intergenic
1020660680 7:10977781-10977803 TATGGAATTACCAGTTTTGTAGG + Intronic
1020711431 7:11610401-11610423 GAAGAAAATACCAATGTTGTAGG + Intronic
1020827233 7:13044493-13044515 CATAAAAATACCAGTCCTGTTGG - Intergenic
1021076930 7:16316375-16316397 CATGACAATATAACTTTTTTGGG - Intronic
1021332093 7:19350689-19350711 CATGAGAATACAACATTTGAAGG - Intergenic
1021589756 7:22248230-22248252 CATCAAAAGATCACATTTGTTGG - Intronic
1022050866 7:26669796-26669818 CAGTAAAATACCACTTTTTATGG - Intronic
1023170685 7:37387584-37387606 CTCGAATATACCATTTTTGTAGG + Intronic
1023739422 7:43265521-43265543 TATGAAATTGCCATTTTTGTAGG - Intronic
1024639556 7:51317631-51317653 TATGAAACTGCCACTTTTATAGG - Intergenic
1024913252 7:54470038-54470060 CATGAAAATACCACACCTGCTGG - Intergenic
1027351703 7:77318261-77318283 CATGAAAGTGCCATTTTTGTTGG + Intronic
1027576468 7:79936805-79936827 CTTGGAGAAACCACTTTTGTGGG - Intergenic
1028047421 7:86140242-86140264 TCTGAAAATAGCACTTTCGTAGG + Intergenic
1030147295 7:106369619-106369641 CATACAAAAACCACTTTTCTTGG - Intergenic
1031492074 7:122401700-122401722 CATTAAATTACCTCTTTAGTAGG + Intronic
1032041318 7:128564636-128564658 CATAAGAATACCAGTTTTATTGG + Intergenic
1032423547 7:131802279-131802301 CATGAAAAAGCCATTTTTGTGGG + Intergenic
1032649314 7:133860018-133860040 TATGAAATTGCCACTTTTGTAGG + Intronic
1033390284 7:140920918-140920940 AATGAGAATACCACTTTTCAGGG + Intronic
1035962230 8:4149809-4149831 TATTAAAATACCACTTTAATTGG + Intronic
1036492420 8:9240332-9240354 CATGAACAAGTCACTTTTGTGGG - Intergenic
1037735308 8:21561148-21561170 CATGGAAAGACCACGTTTGCAGG - Intergenic
1039683640 8:39770994-39771016 TATGAAATTGCCACTTTTTTAGG - Intronic
1040296904 8:46154594-46154616 GTTGGAAATACTACTTTTGTAGG - Intergenic
1040346518 8:46504899-46504921 GATGGAAATACCGTTTTTGTAGG - Intergenic
1040378387 8:46848673-46848695 CATGAAACCAGAACTTTTGTGGG + Intergenic
1040654778 8:49494419-49494441 CATGAAATTACCAGTTTATTTGG + Intergenic
1040757846 8:50802458-50802480 CCTGGAATTTCCACTTTTGTAGG + Intergenic
1041607987 8:59807490-59807512 TATCAAAATATCAGTTTTGTAGG - Intergenic
1042442436 8:68843854-68843876 CATTTAAATACCACTTCTGTGGG + Intergenic
1042528103 8:69786610-69786632 CATGAAAAGATCACTTTCTTGGG - Intronic
1042974371 8:74450008-74450030 CATTAAAATACTACTTTAGCTGG + Intronic
1043303976 8:78771023-78771045 CATGAAATCACCACTTTCCTAGG + Intronic
1046137593 8:110049431-110049453 TATTAAAATATCATTTTTGTGGG + Intergenic
1046206389 8:111003694-111003716 AATGAATATACCACTCTAGTTGG + Intergenic
1046273293 8:111923777-111923799 TAGGAAATTACCACTTTTATAGG + Intergenic
1046317224 8:112520299-112520321 GATGAAAATACCACTTTGTAAGG - Intronic
1046580420 8:116085898-116085920 CATGAAAATAACATTATTTTTGG + Intergenic
1047267684 8:123322871-123322893 CATTAATATATCACTTATGTAGG - Intronic
1047568913 8:126076200-126076222 GATGAAAATAAAAGTTTTGTAGG + Intergenic
1048252048 8:132874709-132874731 CATGAAATTTCTATTTTTGTAGG + Intronic
1050113252 9:2238200-2238222 CATGAAATGAAAACTTTTGTGGG - Intergenic
1050621853 9:7462021-7462043 GATAAAAATACCAGTTTTGCAGG + Intergenic
1051765973 9:20524161-20524183 CAAGAATATACCACTCTGGTAGG + Intronic
1054931546 9:70640517-70640539 CATGAAAAGCCCACTTTGGTTGG - Intronic
1057965433 9:99498679-99498701 TATGAAATTGCCATTTTTGTGGG - Intergenic
1058038383 9:100277900-100277922 GATGATAATTCCACTTCTGTTGG - Intronic
1058458518 9:105160733-105160755 CATTAAAATGCAAGTTTTGTAGG + Intergenic
1058505823 9:105665098-105665120 AATCAAAATAACACTTTTGACGG + Intergenic
1058991631 9:110259204-110259226 CATAAAAATATCATTTTTGCTGG - Intergenic
1059080585 9:111244933-111244955 AATGCAAATACCATTTTTGGAGG + Intergenic
1060333535 9:122698989-122699011 AATGAAAGTACCTATTTTGTTGG + Intergenic
1186013420 X:5163924-5163946 CATAACAAGACCACTTTTGCTGG + Intergenic
1186794891 X:13036713-13036735 CATTAACATACCACTTTTTAGGG - Exonic
1186884191 X:13896515-13896537 CATGAAATTGCTAGTTTTGTAGG + Intronic
1188531598 X:31147050-31147072 CAAGAAAAAACCATTTTGGTAGG + Intronic
1188574435 X:31629801-31629823 CATGAAACTGCCACTTTTATAGG - Intronic
1189054719 X:37686465-37686487 CAAGAAACTGCCATTTTTGTTGG - Intronic
1192245986 X:69371940-69371962 TAGGAAATTGCCACTTTTGTAGG - Intergenic
1192264041 X:69526429-69526451 CATGAAAATTCCAGTTTCATGGG - Intronic
1192309042 X:69994215-69994237 GAAGAAAATATCACTTGTGTAGG - Intronic
1192436201 X:71145219-71145241 CATCAAAATACCCCTATTGAGGG + Intronic
1193836030 X:86345112-86345134 CTTTGAATTACCACTTTTGTGGG - Intronic
1194265592 X:91749909-91749931 AATGAAAAGAGCATTTTTGTAGG + Intergenic
1194710326 X:97228389-97228411 TTTGAAAATACTATTTTTGTGGG + Intronic
1196055205 X:111348266-111348288 CATGAAAATACCAGTGGTATGGG + Intronic
1196708965 X:118742894-118742916 TGTGAAATTACCACTTTTATGGG + Intronic
1197378960 X:125714854-125714876 CATGAAAATACCTATATTTTTGG + Intergenic
1197528708 X:127595156-127595178 TATGAAATTACTATTTTTGTAGG + Intergenic
1198209303 X:134501830-134501852 TATGAAATTACCATTTTTGCAGG + Intronic
1198943791 X:141987235-141987257 AAAGAAAATACCATTTTTCTGGG + Intergenic
1199935218 X:152566888-152566910 AATGGAAATACAAGTTTTGTGGG - Intergenic
1200506867 Y:4022580-4022602 CCTGCAAACACCAATTTTGTTGG - Intergenic
1200582742 Y:4970351-4970373 AATGAAAAGAGCATTTTTGTAGG + Intergenic
1201154375 Y:11116322-11116344 CAGGAAAATACCACTATGCTTGG - Intergenic
1201541841 Y:15113438-15113460 CATGATAAGACCACTTATGTGGG + Intergenic