ID: 957548735

View in Genome Browser
Species Human (GRCh38)
Location 3:81676235-81676257
Sequence CTGTGAACACTGTGGGGGCT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 390
Summary {0: 1, 1: 0, 2: 4, 3: 49, 4: 336}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
957548735_957548741 -4 Left 957548735 3:81676235-81676257 CCTAGCCCCCACAGTGTTCACAG 0: 1
1: 0
2: 4
3: 49
4: 336
Right 957548741 3:81676254-81676276 ACAGGTCAGCTGTATAGTCTTGG 0: 1
1: 0
2: 1
3: 9
4: 111
957548735_957548742 9 Left 957548735 3:81676235-81676257 CCTAGCCCCCACAGTGTTCACAG 0: 1
1: 0
2: 4
3: 49
4: 336
Right 957548742 3:81676267-81676289 ATAGTCTTGGAGCAACATTTAGG 0: 1
1: 1
2: 0
3: 7
4: 148

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
957548735 Original CRISPR CTGTGAACACTGTGGGGGCT AGG (reversed) Intronic
900667829 1:3827619-3827641 CAGTGCACACTGTGGTGGCATGG - Intronic
900954747 1:5879646-5879668 GTGTGATCAATGTGGTGGCTCGG + Intronic
902712212 1:18248229-18248251 CTGTGTACACAGTGGGAGCCTGG + Intronic
903300563 1:22375765-22375787 CTGGGAACACAGTGGATGCTCGG + Intergenic
903656534 1:24952221-24952243 CTATAAGCACTGTGGGGGCGGGG - Intronic
904326738 1:29731427-29731449 CTTTGAACACTGTGGAGCCTTGG - Intergenic
905183385 1:36179669-36179691 CTGTGAAAGCTGTGGAGGCTCGG + Exonic
906041140 1:42788570-42788592 CTGGGAGCACTGGGGGGCCTGGG + Intronic
906674611 1:47684218-47684240 ATGAGAGCACTTTGGGGGCTGGG - Intergenic
907253536 1:53160349-53160371 TTGTGAACACTGTGGGGACTTGG + Intergenic
907284537 1:53371308-53371330 CTGATAACCGTGTGGGGGCTGGG - Intergenic
907633348 1:56106869-56106891 ATGTGGCCACTGTGGGGGATGGG - Intergenic
911305596 1:96228282-96228304 CTGTGAAGACTGTGGGGAGAGGG - Intergenic
911402071 1:97387868-97387890 CTCTGAACCCTGTGGGAGATTGG + Intronic
912769539 1:112451092-112451114 CTGTGAATACTGGGGAGGATGGG - Intronic
913198249 1:116475643-116475665 CTGAGAGAACTGTGGGGGCCAGG + Intergenic
915476444 1:156155452-156155474 CTGTGAACACCTTGAGGGCAGGG - Intronic
915606420 1:156954694-156954716 CTGCAAACCCTGTGGGGGATTGG - Intronic
917949373 1:180014798-180014820 CTTTGAACGATGTGGGGGTTGGG + Intronic
918972123 1:191433188-191433210 CTATGCCCACTGTGGGGGATGGG - Intergenic
920847905 1:209608887-209608909 CTGTGTATACAGTGGGAGCTTGG + Intronic
920880247 1:209873252-209873274 TTGTGAACACTTTGAGGTCTAGG - Intergenic
921331528 1:214043374-214043396 CTGTGAACAGAGGGAGGGCTGGG - Intergenic
922343640 1:224677794-224677816 TTGTCCACAATGTGGGGGCTTGG + Intronic
922785093 1:228278666-228278688 CTGTGAACGTGGTGGGGGCATGG - Intronic
922792435 1:228317695-228317717 CTGTGGGCCCTGTGGGTGCTGGG + Exonic
923861321 1:237894729-237894751 CCTTGAACAATGTGGGGGCTAGG + Intergenic
924570890 1:245236783-245236805 CCGTGAGCCCCGTGGGGGCTGGG + Intronic
1063683837 10:8216780-8216802 CTGTGAACCTTTTGGGGACTGGG + Intergenic
1064645384 10:17454365-17454387 CTGTGAACGCTGTGGGTGCGCGG - Intergenic
1066648750 10:37636143-37636165 CCTTAAACAATGTGGGGGCTAGG + Intergenic
1067031635 10:42881833-42881855 CCTTAAACAATGTGGGGGCTAGG + Intergenic
1067513949 10:46920700-46920722 CTGAGGCCACTGTGGGGGCTGGG + Intronic
1067648305 10:48131132-48131154 CTGAGGCCACTGTGGGGGCTGGG - Intergenic
1068607021 10:59016851-59016873 CTGGGAACACAGTGGCTGCTTGG - Intergenic
1070121075 10:73577967-73577989 CTGTGAGCAAAGTGGAGGCTTGG - Intronic
1070856012 10:79608570-79608592 CTGTGGACTCTGAGGTGGCTTGG + Intergenic
1072871637 10:99126277-99126299 CTGCGGCCACTGTGGGGGATTGG - Intronic
1074961486 10:118449730-118449752 CTGTGATCACTCTGGCTGCTGGG - Intergenic
1076124413 10:127962816-127962838 CCGTGGACATTGCGGGGGCTGGG - Intronic
1076257172 10:129036770-129036792 CCCTGCACACTGTAGGGGCTGGG - Intergenic
1077141837 11:1028168-1028190 CTGTCAGAACTGTGGGCGCTGGG + Intronic
1077409629 11:2397489-2397511 CTGTGGACTCTGTGGGGTCCAGG + Intergenic
1077552036 11:3204696-3204718 CTGAGAACACTGTGTGAGCAAGG + Intergenic
1078175000 11:8963962-8963984 CTGTGGGCACTGTCGGGGCTGGG + Intronic
1078406309 11:11072991-11073013 CAGTGAACTCACTGGGGGCTTGG - Intergenic
1079370943 11:19851742-19851764 ATGTGAACATTGTTGGGGATGGG - Intronic
1081155447 11:39684147-39684169 CTGTGAAGACTGAGGTGGATTGG + Intergenic
1082594381 11:55057631-55057653 CTGTGAACACATTGAGGTCTAGG - Intergenic
1083720835 11:64602776-64602798 CTGTGGACACTGTGGGCCCCTGG - Intergenic
1084909030 11:72372805-72372827 CTGGGCACACAGTGGGTGCTGGG + Intronic
1085439150 11:76542228-76542250 CTGGGAAGGCTGTTGGGGCTGGG - Exonic
1085707613 11:78800712-78800734 CTGTGAACTCTGTGAGGTCAGGG - Intronic
1086587326 11:88469449-88469471 CCTTGAACAATGTGGGGGTTAGG + Intergenic
1087615934 11:100486730-100486752 CTGTGACTGCTGTGGGGGATGGG - Intergenic
1088543995 11:110941615-110941637 CCTTGAACAATGTGGGGGTTAGG + Intergenic
1089710063 11:120308214-120308236 CTGTGAGCCCCGTGTGGGCTGGG + Intronic
1091380786 12:57198-57220 CTGTGGCCACTGTGGGGGATGGG - Intergenic
1091404773 12:202368-202390 CTGTAAACACAGTGAAGGCTGGG + Intronic
1092981841 12:13803303-13803325 CCTTGAACAATGTGGGGGTTAGG - Intronic
1093805316 12:23425380-23425402 CCTTGAACACTGTGGGGATTAGG - Intergenic
1093896680 12:24582708-24582730 CTTTGAACAATGTGGGGGTTAGG + Intergenic
1094362101 12:29641060-29641082 CTGTGGCTGCTGTGGGGGCTGGG - Intronic
1098017791 12:66124839-66124861 CTGTAAACTCCGTGAGGGCTAGG - Intronic
1098719573 12:73879908-73879930 ATGTGAACCCCGTGGGGGCATGG + Intergenic
1099041988 12:77667572-77667594 GTGTGACTACTGTGGGGGATGGG - Intergenic
1099777423 12:87151342-87151364 CTGTGGCTACTGTGGGGGATGGG + Intergenic
1101695126 12:107118567-107118589 CTGTGATCACTGATGGTGCTGGG - Intergenic
1102492667 12:113298267-113298289 CTGTGAGCTCTGTGGGCCCTGGG + Exonic
1103128987 12:118450399-118450421 CTGTGAACCCTGAAGGGTCTTGG - Intergenic
1105412764 13:20185025-20185047 CTGTGAACACTGGGGCAGCTGGG + Intergenic
1106285321 13:28313554-28313576 CTGTAAGCACTATGTGGGCTGGG + Intronic
1106801091 13:33256413-33256435 AAGTGAAAACTGTGGGGCCTGGG - Intronic
1107361150 13:39618940-39618962 CTGTGGCCACTGTGGGGGATGGG - Intergenic
1107702053 13:43058476-43058498 CTGTGGCCACTGTGGGGTATGGG + Intronic
1108564806 13:51685334-51685356 CTTTGAACAATGTGGGGGTTAGG + Intronic
1111225594 13:85266740-85266762 CTGTGGACACTGTGGAGGATGGG - Intergenic
1111330528 13:86758884-86758906 ATGTTAACTTTGTGGGGGCTAGG + Intergenic
1111684617 13:91486966-91486988 CTGTGACTGATGTGGGGGCTAGG + Intronic
1111814413 13:93132614-93132636 CTGTGAAGAATGTTGGGGTTTGG - Intergenic
1112398271 13:99053146-99053168 ATGTGAACACAGTGGCAGCTGGG - Intronic
1112557194 13:100479345-100479367 CCTTGAACAATATGGGGGCTAGG + Intronic
1113648342 13:112014832-112014854 CTGTCAACACTGAGGGTGCCAGG - Intergenic
1113965193 13:114149021-114149043 CTGGGATCTCCGTGGGGGCTGGG + Intergenic
1115369209 14:32593064-32593086 CTGTGAGCTCTGTGAGGGCAGGG + Intronic
1116008369 14:39322245-39322267 TTGTTAACACACTGGGGGCTGGG + Intronic
1116502767 14:45640248-45640270 CTGTGAAGAATGTAGGGGTTAGG - Intergenic
1118048939 14:62005002-62005024 CAGTGAACACTGTGTGGGTGGGG + Intronic
1118757462 14:68855368-68855390 TTGTGATCACTGATGGGGCTCGG - Intergenic
1119430577 14:74565682-74565704 CTGTAGACACAGTTGGGGCTGGG + Intronic
1121007664 14:90500646-90500668 ATGTGAGCACAGTGGGGGCCTGG + Intergenic
1121991623 14:98563345-98563367 TTGGGGACACTGTGGGAGCTGGG - Intergenic
1122803506 14:104244916-104244938 CAGTGGACACTGTGGGCTCTGGG + Intergenic
1123126365 14:105948954-105948976 CTGTTAACACTGTGGGGAGAAGG + Intergenic
1124340972 15:28888942-28888964 CTGTGTGCCCGGTGGGGGCTGGG + Intronic
1125591027 15:40854512-40854534 CTGTGAAAAATGTGAGGCCTGGG + Exonic
1125845105 15:42844949-42844971 CTGTGAACTCTTTGAGGGCATGG - Intronic
1126526721 15:49664328-49664350 CTGTGAACTCCCTGTGGGCTGGG + Intergenic
1127574080 15:60273156-60273178 CAGTGGCCACTGTGGGGGATGGG + Intergenic
1127707310 15:61560015-61560037 CCGTGAACAATGTGGGGGTTAGG + Intergenic
1127974686 15:63988388-63988410 CAGTGAAGACTTTGGGGGGTGGG - Intronic
1127976206 15:63999038-63999060 CTGTGTACTTTGTGGGGGATTGG - Intronic
1129392994 15:75229749-75229771 CTGTGCACCCGGTGGGGGCCAGG + Intergenic
1130772163 15:86935475-86935497 CTGTGACCACTATGGTGGCATGG - Intronic
1131711321 15:95059500-95059522 CTGCTACCACTGTGGGGGGTGGG + Intergenic
1132083255 15:98885171-98885193 CTGTGAGCCCTGGGAGGGCTGGG + Intronic
1133256653 16:4521294-4521316 CTGAGACCACTCGGGGGGCTAGG - Intronic
1133372254 16:5254044-5254066 CTGTGGTCACTGTGAGGGCCAGG + Intergenic
1134863425 16:17582469-17582491 CTGTGAACACAGTGGGGAAAAGG + Intergenic
1134909625 16:18012975-18012997 CTGTGATCACGGTGGTGGCTGGG - Intergenic
1134912024 16:18036124-18036146 CTGGGAACACTGAGGGGGAAAGG + Intergenic
1135700589 16:24628802-24628824 CTTTGAACAATGTGGGAGTTAGG - Intergenic
1136387012 16:29934537-29934559 CCTTGAACATTGTGGGGGTTAGG + Intergenic
1137811757 16:51359320-51359342 CTGAGACCACTGCGGTGGCTGGG + Intergenic
1138077388 16:54056287-54056309 CTGTAAACTCTGTGAGGGCGGGG + Intronic
1138337810 16:56266951-56266973 ATGTGGACACGGTGGCGGCTGGG - Intronic
1139525969 16:67516913-67516935 CTGTGAGCTCTGTGGGGCCAGGG - Intergenic
1139745203 16:69068626-69068648 CTGTGACCTCTGTGAGGGCCAGG - Intronic
1140594540 16:76393517-76393539 CTGTGAGCACTTTGGGGCCCAGG - Intronic
1140731171 16:77858113-77858135 CTGTGAGCTCTGTGGGGGCAGGG - Intronic
1140843971 16:78869193-78869215 CTGTGGACTCTGTGGTGGGTGGG + Intronic
1141208358 16:81953351-81953373 ATGTTAACACTGTGGAGTCTAGG + Intronic
1141808109 16:86355430-86355452 CTGTGAGCTCTGTGGGGGAAGGG - Intergenic
1142144333 16:88486559-88486581 CTGGGTACACAGTGGGTGCTAGG + Intronic
1142398692 16:89847941-89847963 CTGTGGACCGTGTGGGGGTTGGG + Intronic
1142645722 17:1312813-1312835 CTGGGAAGACTGTGGGGGTCTGG - Intergenic
1142910868 17:3089711-3089733 CTGTGGCCACTGTGAGGGATGGG + Intergenic
1144774001 17:17775142-17775164 CCTTGAACAATGTGGGGGTTAGG + Intronic
1145100570 17:20073212-20073234 CTGTGAACACTGTGAGTTCTAGG - Intronic
1147796118 17:43044380-43044402 CCTTGCACACTGGGGGGGCTAGG + Intronic
1148484193 17:47980136-47980158 CTCTGAACACTGTAAGCGCTAGG - Intronic
1149370586 17:55990417-55990439 CTGTGAACACCTGGAGGGCTGGG - Intergenic
1150289647 17:63973893-63973915 CTGTGAGCATTGTGTGGTCTGGG + Intergenic
1150896160 17:69213381-69213403 CTGTGACCACTGTGGGCGACAGG + Intronic
1151332280 17:73417466-73417488 CCTTGAACAGTGTGGGGGCTAGG - Intronic
1152249218 17:79202932-79202954 CTGAGACCACTGTGGGCGCTGGG - Intronic
1152910116 17:82999422-82999444 CCCTGAACAATGTGGGGGTTAGG + Intronic
1153688333 18:7567675-7567697 CTGTTGGCACTTTGGGGGCTTGG + Exonic
1153731161 18:8013265-8013287 CCTTGAACAGTGTAGGGGCTGGG + Intronic
1154332943 18:13444570-13444592 CTTTGAACAATTTGGGGGTTGGG - Intronic
1156802315 18:41131195-41131217 CTCTGAAAACTGTGGGATCTAGG - Intergenic
1157030511 18:43901271-43901293 CTTTGAACAATATGGGGGTTAGG - Intergenic
1157592159 18:48842501-48842523 CTGGGAACACTGTGAGGCCAGGG - Intronic
1158764040 18:60426113-60426135 CTGTGAACACTCTGGAGGGCTGG + Intergenic
1160389300 18:78518166-78518188 CTGTGCTCCCTGTGGAGGCTCGG - Intergenic
1160617756 18:80146583-80146605 CTGTCATCACTGTGGGCTCTTGG + Intronic
1160808949 19:1004715-1004737 CTGGGCACCCTGTGGGGGCGGGG - Exonic
1161076585 19:2288707-2288729 CTGTGACCACCGTGTGTGCTGGG + Intronic
1161414579 19:4138634-4138656 CTGTAAACTCTGTGAGGGCAGGG - Intergenic
1162349533 19:10140239-10140261 CTGTGAACACTGTGGAGCCGGGG + Exonic
1163818024 19:19479327-19479349 CTGTTAACAATGTGGAGACTGGG - Intronic
1164768951 19:30793196-30793218 CTTTGAACATTGTGGTGGTTTGG + Intergenic
1164949271 19:32322770-32322792 CTGGGAACTGTGTTGGGGCTGGG - Intergenic
1165712069 19:38018861-38018883 CTCTGGACACTGTGTGGGGTAGG - Intronic
1165778469 19:38418421-38418443 CTGTGCACGCTGTAGGGGCCCGG + Exonic
1166053350 19:40274241-40274263 CTGGGGACACAGTGGGGGCTAGG - Intronic
1166447552 19:42871481-42871503 CTGTGAACACAGTGGGGATTTGG - Intronic
1167094838 19:47369635-47369657 CGGTGGGCACAGTGGGGGCTGGG + Intronic
1167109207 19:47448946-47448968 CTGTGAACCCTGTGAGGACAGGG - Intronic
1167175855 19:47863926-47863948 CTGTGGACATTCTGGGGGCATGG + Intergenic
926397071 2:12454336-12454358 CTCTGATGATTGTGGGGGCTTGG - Intergenic
926872752 2:17441221-17441243 CTGTGAATGCTGTGGGGGTTGGG + Intergenic
927647288 2:24886153-24886175 CTGGGAACACAGTGGGGACTGGG - Intronic
928322665 2:30295857-30295879 CTGTGAAGAGTGATGGGGCTGGG - Intronic
929809581 2:45178510-45178532 CTGGGAACACTGTGGAGCCCTGG + Intergenic
930345163 2:50170814-50170836 CCTTGAACAATGTGGGGGTTGGG + Intronic
930422022 2:51165797-51165819 CTGTGACCAGTGTGGGGGCTGGG + Intergenic
930928970 2:56857681-56857703 CTGTGAATTCTGTCTGGGCTAGG + Intergenic
931225560 2:60326712-60326734 CAGTGAACCCTGTGGGGCCTTGG - Intergenic
931225727 2:60328307-60328329 CAGCGAACCCTGTGGGGCCTTGG - Intergenic
932202260 2:69840489-69840511 CATAGATCACTGTGGGGGCTGGG + Intronic
932203601 2:69856752-69856774 AAGTGCACACTGAGGGGGCTAGG - Intronic
932216138 2:69967202-69967224 CTGTGAACTCTGTGAGGGTAGGG - Intergenic
932408007 2:71526773-71526795 CTGTGAAGACAGTGGGGCCCAGG - Intronic
934111416 2:88747122-88747144 CTGTGGCCACTGTGTGGGGTTGG + Intronic
936115475 2:109699325-109699347 TCGTGAACAATGCGGGGGCTAGG + Intergenic
936182000 2:110275106-110275128 CTGGGACCACAGTGGGGGCCTGG + Intergenic
936230569 2:110696567-110696589 CTGGGACCACAGTGGGGGCCTGG - Intergenic
936459897 2:112705902-112705924 CAGTGACCACTGTGGGCTCTAGG + Intergenic
938854875 2:135299176-135299198 CTGCATCCACTGTGGGGGCTTGG + Intronic
939018652 2:136932395-136932417 CCTTGAACACTGTGGGGGTTTGG + Intronic
940520885 2:154746343-154746365 CCTTAAACAATGTGGGGGCTAGG - Intronic
940572049 2:155448672-155448694 CTGCGATTACTGTGGAGGCTGGG + Intergenic
942740292 2:179168474-179168496 CTGTGAACAATGCAGGGGTTAGG - Intronic
942980400 2:182073807-182073829 CTTTGAACACTGTGGGGTGGGGG + Intronic
943995457 2:194759603-194759625 ATGTGAGGTCTGTGGGGGCTAGG - Intergenic
944073122 2:195695272-195695294 CTGTGGCCGCTGTGGGGGATGGG + Intronic
946930303 2:224663962-224663984 CTCTGAATACTGTGAGGTCTGGG + Intergenic
947871324 2:233440484-233440506 CTGGGAACCCGGTGGGGGCAGGG + Intronic
948794230 2:240393949-240393971 CTGTGAGCCCTGTGGGTGCCGGG - Intergenic
1170419353 20:16177251-16177273 CCTTGAACAATGTGGGGGTTAGG - Intergenic
1170520473 20:17179892-17179914 CTGTGACCTCTATTGGGGCTTGG - Intergenic
1172511696 20:35505198-35505220 CTGTGAACTCTGTGAGGGCAGGG - Intronic
1172858471 20:38027415-38027437 CCTTGAACAATGTGGGGGTTAGG + Intronic
1173620368 20:44431501-44431523 GTGTGCACAGTGTGGGGGCAGGG + Exonic
1174463530 20:50699722-50699744 CTGTGCCCAGAGTGGGGGCTTGG - Intergenic
1174746251 20:53066369-53066391 ATGTGAAAATTGTGGGGGGTGGG - Intronic
1175405364 20:58722604-58722626 CTGTGAACCCTGGGAGGGCAGGG - Intergenic
1175539304 20:59738247-59738269 CTGTGAAGAACATGGGGGCTGGG - Intronic
1175569054 20:60005328-60005350 CCTTGAACAATGTGGGGGTTAGG - Intronic
1177038151 21:16071120-16071142 CTGAGAACGCTGTCTGGGCTTGG + Intergenic
1177259256 21:18707459-18707481 CCTTGAACAATGTGGGGGTTGGG - Intergenic
1180181664 21:46120968-46120990 CTGTGGACACTGCAGGGCCTCGG - Intronic
1180716010 22:17872987-17873009 CTGTGAGCACTGTGTTGGCATGG - Intronic
1180975529 22:19845790-19845812 GTGTGAACACTGCTGGGGCTGGG + Intronic
1184240913 22:43210871-43210893 CTGGGAACACGGGAGGGGCTGGG - Intronic
1184425347 22:44405980-44406002 CTGTGAACATGGAGGAGGCTGGG - Intergenic
1184512024 22:44939529-44939551 CTGTGAGCACAGTGGGGACCAGG + Intronic
952984887 3:38770424-38770446 CTGTGGCCACTGTGGTGGATGGG + Intronic
953180473 3:40589963-40589985 CTGTGATCAGTGTGGGTGCAGGG + Intergenic
953274441 3:41481184-41481206 CCCTGAACAATGTGGGGGTTAGG - Intronic
954226800 3:49187141-49187163 CTCTCAAAACTGTGGGAGCTTGG + Intronic
954671247 3:52292402-52292424 CTGTGAAGACTGTGCTGTCTCGG + Exonic
955450771 3:59064695-59064717 CTATGGCCACTGTGGGGGATGGG + Intergenic
955539517 3:59959691-59959713 CTGTGAACACTGTGAGGCCAGGG - Intronic
957548735 3:81676235-81676257 CTGTGAACACTGTGGGGGCTAGG - Intronic
959235410 3:103715573-103715595 CCTTGAACAATGTGGGGGTTAGG + Intergenic
960153124 3:114271373-114271395 CTGTGGGCACTGTGGGGGATAGG + Intergenic
960557158 3:119042588-119042610 CTGCCACCACTGTGGGGGGTAGG - Intronic
961361781 3:126372715-126372737 CTCAGGACACTGTGGGGGCCAGG + Intergenic
961965623 3:130899194-130899216 CCTTGAACAATGTGGGGGTTGGG + Intronic
962673751 3:137736307-137736329 CTGAGGCCACTGTGGGGGATGGG + Intergenic
962687043 3:137857743-137857765 CTGAGAATAGTGTGGTGGCTTGG - Intergenic
963183621 3:142388480-142388502 CTTTGAACAGTGTGGGAGGTAGG - Intronic
964075647 3:152688576-152688598 GTGTGAGCTCTGTGGGAGCTGGG + Intergenic
964113466 3:153111186-153111208 TTTTGAACAATGTGGGGGGTTGG - Intergenic
964402898 3:156317742-156317764 TTGTGAAAAGTGTGAGGGCTGGG - Intronic
964483968 3:157168233-157168255 TTGTGTATATTGTGGGGGCTGGG + Intergenic
966168087 3:177044264-177044286 CTTTGAACAATGTGAGGGTTAGG + Intronic
966589220 3:181661731-181661753 CTGATATCATTGTGGGGGCTAGG - Intergenic
966760414 3:183413160-183413182 CTTTGAACAATGTAGGAGCTGGG + Intronic
967232512 3:187353673-187353695 CCTTGAACAATGTGGGGGTTAGG + Intergenic
967990135 3:195124522-195124544 CTGTGAATTCCGTGGGGGCAAGG + Intronic
969014369 4:4093849-4093871 CTGTGGTCACTGTGAGGGCCAGG - Intergenic
970807761 4:20056010-20056032 CTTCTAACACGGTGGGGGCTAGG - Intergenic
976429219 4:84943654-84943676 CTTTGAACCATGTTGGGGCTAGG - Intronic
976501619 4:85796981-85797003 GTGTGTACACTGGAGGGGCTGGG + Intronic
976737597 4:88326533-88326555 CCCTGAATAATGTGGGGGCTAGG - Intergenic
976802492 4:89008238-89008260 CTGTGGGCACATTGGGGGCTAGG - Intronic
978257108 4:106705494-106705516 CTGTGAACTCTCTGGAGACTTGG + Intergenic
978290820 4:107137688-107137710 CTATGGTCACAGTGGGGGCTTGG + Intronic
978827973 4:113047616-113047638 CTGTGACCACAGTGGGAGTTGGG + Intronic
979499132 4:121418798-121418820 CTGTGACTGCTGTGGGGGTTGGG + Intergenic
979995472 4:127426187-127426209 CTGTGACTGCTGTGGGGGATGGG - Intergenic
980289083 4:130822178-130822200 GTGTGAAGAGTGTGGGAGCTGGG + Intergenic
980363215 4:131764817-131764839 CTGTGACCACAGCGGCGGCTCGG - Intergenic
981341286 4:143624677-143624699 CTATGAACTTTCTGGGGGCTGGG - Intronic
981442544 4:144799445-144799467 CTGTGGCCACTGTGGGGGATGGG + Intergenic
983692405 4:170486799-170486821 CCTTGAACAATGTGGGGGTTAGG + Intergenic
984379174 4:178968596-178968618 CTATGAACAATGTTGGGGTTAGG + Intergenic
984655101 4:182309018-182309040 CTGTGGAGACAGTAGGGGCTAGG - Intronic
984984385 4:185313707-185313729 CCTTGAACAATGTGGGGGTTAGG + Intronic
985149746 4:186934499-186934521 CTGTGAGCACTGTCAGGGCAGGG + Intergenic
986309131 5:6538669-6538691 GTGTGTACAATGTGGGGGTTAGG - Intergenic
986485310 5:8229966-8229988 CTGTGCACACTGTAGAGGCAAGG - Intergenic
987102614 5:14605311-14605333 CTGTGTACAGTCTGGGGACTTGG - Intronic
987434922 5:17883244-17883266 CTGTGGTCACTGTTGGGGGTAGG + Intergenic
987664443 5:20918952-20918974 CTTTGAACAGTGTAGGGGTTGGG + Intergenic
988758240 5:34283241-34283263 CTTTGAACAGTGTAGGGGTTGGG - Intergenic
988886384 5:35563066-35563088 CTGTGTGCACTGTAGGGACTTGG + Intergenic
991923876 5:71684394-71684416 CTGTGACTATTGTGGGGGATTGG - Intergenic
992237632 5:74728145-74728167 CCTTGAATAATGTGGGGGCTAGG + Intronic
992485966 5:77195544-77195566 CCTTGAACACTGTGGGGGTAAGG + Intergenic
993423696 5:87735062-87735084 CTGAGAACAATGATGGGGCTGGG - Intergenic
993602957 5:89952054-89952076 CTGTGAATTCTGAGAGGGCTGGG - Intergenic
994130009 5:96216306-96216328 CCTTGAACAATGTGGGGGTTAGG - Intergenic
995834992 5:116391340-116391362 CCTTGAACACTGAAGGGGCTAGG - Intronic
996141348 5:119913372-119913394 CTGTGGCCACTGTGGGGGATGGG + Intergenic
996609016 5:125357632-125357654 CTGTGGCCACTGTGGGGGATGGG + Intergenic
998385521 5:141755008-141755030 CTGGGATTCCTGTGGGGGCTGGG + Intergenic
999244318 5:150145403-150145425 CCTTGAACAATGAGGGGGCTGGG - Intronic
999930984 5:156432637-156432659 CTGTGGCCACTGTGGGGGATAGG + Intronic
1000264484 5:159621523-159621545 CTGTGATCACTGTGGGGGATGGG - Intergenic
1001012786 5:168113602-168113624 CAGAGAACTTTGTGGGGGCTGGG + Intronic
1001383745 5:171320973-171320995 CCTTGAACAATGTGGGGGTTAGG - Intergenic
1001949964 5:175809445-175809467 CTGTGCACATTGTAGGTGCTTGG + Intronic
1002171690 5:177378277-177378299 CTGTGAAAACTGTAGGGTCTGGG + Intergenic
1003346694 6:5275471-5275493 ATGTGAATTCTGTGAGGGCTGGG + Intronic
1005259473 6:24042695-24042717 CTGCAGCCACTGTGGGGGCTGGG + Intergenic
1005514057 6:26537890-26537912 GTTTGAACACTGGAGGGGCTGGG + Intergenic
1005819926 6:29589365-29589387 CTGTGGACACTGTGTGTTCTTGG - Intronic
1006096900 6:31661747-31661769 CTGTGAACTCTTTGAGGGTTGGG + Exonic
1006948334 6:37800560-37800582 ATGTGGACACTGAGGGGGCTGGG - Intergenic
1007083673 6:39127515-39127537 CTGTGGAGACTGTGGGAGCCTGG - Intergenic
1007089679 6:39174758-39174780 CTTTGAACAACATGGGGGCTAGG - Intergenic
1007255666 6:40526596-40526618 CTCTGTCCACTGTGAGGGCTAGG + Intronic
1007520757 6:42450783-42450805 CTGCGGGCTCTGTGGGGGCTGGG - Intronic
1007696352 6:43736536-43736558 ATGTGAGCACTGTGAGGCCTTGG + Intergenic
1007892652 6:45310249-45310271 CTGTGGCTACTGTGGGGGATGGG - Intronic
1008185896 6:48389585-48389607 CTGTGGCCACTGTGGGGGATGGG + Intergenic
1009866919 6:69409156-69409178 CTGTGACTGCTGTGGGGGATGGG - Intergenic
1010358581 6:74965641-74965663 CTGTGACCACTATAGGGGATTGG + Intergenic
1011019052 6:82789925-82789947 CAGTGGTCACTGTGGGGCCTTGG + Intergenic
1011114621 6:83876255-83876277 CTTTGCACACTGTGGGGATTGGG + Intronic
1011168627 6:84479468-84479490 CTGTGGATGCTGTGGGGGCTGGG - Intergenic
1011652648 6:89521185-89521207 CTGTGAGCACTGTGAGGGCAAGG - Intronic
1012869824 6:104659489-104659511 CTGTGGCCACTGTGGGGGATGGG - Intergenic
1012915249 6:105162953-105162975 CAGTGACCACTGTGTGGCCTGGG - Intronic
1013448729 6:110257962-110257984 CTAAGAACAGTGTGGTGGCTGGG + Intronic
1014029918 6:116689013-116689035 GTTAAAACACTGTGGGGGCTAGG + Intronic
1015525285 6:134170251-134170273 CTCTGAACCCTGTTAGGGCTTGG - Exonic
1015930502 6:138354714-138354736 CTGGGAACACGGTGGGAGCCTGG - Intergenic
1016875964 6:148865047-148865069 CTGTGAACATTATGTTGGCTTGG + Intronic
1017652175 6:156593762-156593784 CCTTGAACAATGTGGGGGTTAGG - Intergenic
1017795811 6:157843243-157843265 CCTTGAACAATGTGGGGGTTAGG + Intronic
1019372846 7:672059-672081 CTGGGAACACAGTGGGGGTAGGG - Intronic
1019518051 7:1448238-1448260 CTGTGCCCACTGGGGTGGCTTGG - Intronic
1020031588 7:4937029-4937051 CTTTAAAGACTGTGTGGGCTGGG - Intronic
1020332369 7:7032668-7032690 TTGTGACCACTGTGGGGGATAGG + Intergenic
1021595951 7:22317184-22317206 CTGTGAGCTTTGTGAGGGCTGGG - Intronic
1022751244 7:33228493-33228515 CATTGAACAGTGTGGGGGTTAGG + Intronic
1022815550 7:33910532-33910554 CTGAGAAAACTTTGGAGGCTGGG + Intronic
1023840805 7:44096521-44096543 AGGGGCACACTGTGGGGGCTGGG - Intergenic
1024210178 7:47196467-47196489 CTGTGATCACTGGGTGTGCTGGG + Intergenic
1024234368 7:47386675-47386697 CTGTGGACACTGTGCTGGATGGG - Intronic
1024342665 7:48283081-48283103 CTGAGCAAACTGTGGGGGCCTGG + Intronic
1026461849 7:70621294-70621316 CTGTATTCACTGTGGGGGCAGGG + Intronic
1026569844 7:71520060-71520082 CTGTGAGCTCTTTGAGGGCTGGG - Intronic
1026897822 7:74020424-74020446 CTGTGACCACCAAGGGGGCTAGG + Intergenic
1027571715 7:79876476-79876498 CCTTGAACAATGTGGGGGGTGGG + Intergenic
1028030487 7:85905968-85905990 CTATGAAGAATGTGGGGGTTAGG - Intergenic
1030251628 7:107451944-107451966 CCTTGAACAATGTGGGGGCTAGG - Intronic
1031808758 7:126339884-126339906 CTGACATCACTGTGGGGGCTTGG + Intergenic
1032369968 7:131339206-131339228 CCTTGAACAATGTGGGGCCTAGG - Intronic
1032895009 7:136240740-136240762 CTGTGAAGACCGTGGGACCTGGG - Intergenic
1034907787 7:154965856-154965878 CCCTGAACAGTGTGGGGCCTAGG - Intronic
1035275551 7:157746087-157746109 CTGTGAGGACTGTGGGGTGTAGG - Intronic
1035362914 7:158325165-158325187 CTGTGGAGATTGTGGGGCCTGGG - Intronic
1036483272 8:9156157-9156179 TCTTGAACAATGTGGGGGCTTGG + Exonic
1037572878 8:20173303-20173325 GAGTGGACAATGTGGGGGCTTGG - Intronic
1039331497 8:36542735-36542757 CTGTAAAAACTGTGGGTTCTGGG - Intergenic
1040937533 8:52796775-52796797 CTGTGTAGACTGTGGAGGCAGGG - Intergenic
1041484063 8:58354657-58354679 CCTTGAACAATGTGGGGTCTAGG - Intergenic
1041869739 8:62619143-62619165 GTGAAAACACTGTGGTGGCTAGG + Intronic
1042725223 8:71868086-71868108 TTGTGAAGTCTCTGGGGGCTGGG + Intronic
1042809143 8:72804894-72804916 CTGTGAAACCTGTGGGGTCCAGG - Intronic
1043115620 8:76250373-76250395 CCTTGAACAATGTGGGGGTTAGG - Intergenic
1044014345 8:87032217-87032239 CCTTGAACAATGTGGGGGGTAGG + Intronic
1046280831 8:112028618-112028640 CTGTCAACCCTCTGGTGGCTTGG - Intergenic
1046629071 8:116605349-116605371 CTGTGACCTCTGTGAGGGCAGGG + Intergenic
1047740188 8:127800464-127800486 CTGTTAACACAGTGGGGCCGGGG - Intergenic
1047879968 8:129182282-129182304 CTGTGAATACAGTGGTGTCTTGG + Intergenic
1048008039 8:130434946-130434968 CTGTAATCACTGTGGGCACTGGG - Intronic
1049475713 8:142796122-142796144 CTGAGAACACTGTGGGCGCCAGG + Intergenic
1049680436 8:143915662-143915684 CAGACAGCACTGTGGGGGCTGGG + Exonic
1049805741 8:144537998-144538020 TTCTGAGCACTGTGTGGGCTGGG + Intronic
1052460087 9:28751829-28751851 CTGTGCACAATTTGGGGACTGGG + Intergenic
1053038924 9:34852351-34852373 ATTTGAACAATGTAGGGGCTGGG - Intergenic
1053311666 9:37024638-37024660 CTGGCAGCACAGTGGGGGCTGGG - Intronic
1055007505 9:71525421-71525443 CTGGGAGCAGTGTGCGGGCTCGG - Intergenic
1055394781 9:75862560-75862582 CTGTGATCCTTGTGGGGGCGGGG - Intergenic
1055568739 9:77594909-77594931 CTAGGAACACTGTGGGCCCTTGG + Intronic
1058092656 9:100823290-100823312 CTGTTAACTCTGTGGGGGAAAGG + Intergenic
1059410324 9:114127745-114127767 CTGTGGTCACTGTGCTGGCTGGG + Intergenic
1059486889 9:114633957-114633979 CTGCAAACACTGTGTAGGCTGGG - Intronic
1059715109 9:116906137-116906159 CTGTGAATTCTTTGGGGGCAGGG - Intronic
1060311185 9:122464112-122464134 CTGTGGCTGCTGTGGGGGCTGGG + Intergenic
1061258053 9:129464207-129464229 CAGTGAACCCTGTGGAGGCAGGG - Intergenic
1061877901 9:133554145-133554167 CTGGGAACAGGGCGGGGGCTGGG - Intronic
1062228418 9:135466959-135466981 CGGTGATGACTTTGGGGGCTGGG - Intergenic
1062258580 9:135644529-135644551 CTGTGAACACGGTGCGCACTTGG + Intergenic
1186210635 X:7246636-7246658 CTGTGAACACTGTGCTGGGCAGG - Intronic
1186271647 X:7895461-7895483 CTTTGAACAATATGGGGGTTAGG + Intergenic
1186288585 X:8071971-8071993 CTGTGAATACTGTGGCTCCTTGG + Intergenic
1186638604 X:11431571-11431593 CTGTTAACAATGGTGGGGCTGGG - Intronic
1189027316 X:37408999-37409021 CTTTGAACAATGTGGGGGCTAGG + Intronic
1189192962 X:39126907-39126929 CCTTGAACAATGTGGGGGCTAGG - Intergenic
1191053465 X:56218882-56218904 CTTTGACCACTGTGAGGTCTTGG - Intergenic
1191077297 X:56468871-56468893 CCATGACCACTGTGGGGGATGGG + Intergenic
1191210121 X:57875936-57875958 CTGTGGCCTCTCTGGGGGCTGGG - Intergenic
1191895994 X:65994066-65994088 CTGTGATGACTCTGGAGGCTAGG + Intergenic
1193466118 X:81849573-81849595 CTGAGACCACTGGGTGGGCTGGG - Intergenic
1193554675 X:82938652-82938674 CTGTGAACTCTGTGGGAGAAGGG - Intergenic
1193556509 X:82960617-82960639 CAGTGGCCACTGTGGGGGATGGG - Intergenic
1193771536 X:85593382-85593404 CTGTGGCCGCTGTGGGGGATGGG - Intergenic
1193954651 X:87844679-87844701 CTGTGGCCACTGTGAGGGATGGG + Intergenic
1194053411 X:89100791-89100813 CTGTGCCCACCGTGGGGGATGGG + Intergenic
1195237090 X:102911299-102911321 CTGTGACTGCTGTGGGGGATGGG - Intergenic
1195933634 X:110104864-110104886 CTTTGAACAATGTGGAGGTTAGG - Intronic
1196773447 X:119318273-119318295 CGGTGAAAACTTTTGGGGCTTGG + Intergenic
1196788487 X:119442971-119442993 CTGTGAACTCTGTGAGGACTGGG - Intronic
1197065323 X:122227254-122227276 CGGTGAAAACTTTTGGGGCTTGG - Intergenic
1197721060 X:129744959-129744981 GTGTGAACAGTGTGGGGGCGGGG + Intronic
1198070675 X:133145414-133145436 CTTTTAACAATGTGGGGGCTAGG + Intergenic
1199521514 X:148741309-148741331 CTGTGACTGCTGTGGGGGATGGG + Intronic
1199586832 X:149423645-149423667 CTGTGGCCACTGTGGGGGATGGG - Intergenic
1200124134 X:153805328-153805350 CTCTGAAGGCTGAGGGGGCTGGG - Intronic
1200301705 X:154983053-154983075 CCTTGAACAATGTGGGGGTTGGG - Intronic
1201583936 Y:15539847-15539869 CTGTGAACACTGTGCTGGGCAGG - Intergenic
1201956734 Y:19632951-19632973 CTGTGAAGACCGTCGAGGCTAGG - Intergenic