ID: 957553029

View in Genome Browser
Species Human (GRCh38)
Location 3:81731288-81731310
Sequence TAGCAGTGATCTTAGTTCAG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 121
Summary {0: 1, 1: 0, 2: 1, 3: 7, 4: 112}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
957553029_957553034 30 Left 957553029 3:81731288-81731310 CCCCTGAACTAAGATCACTGCTA 0: 1
1: 0
2: 1
3: 7
4: 112
Right 957553034 3:81731341-81731363 CTTGTTTCACATTAGGTGAATGG 0: 1
1: 0
2: 2
3: 8
4: 147
957553029_957553033 23 Left 957553029 3:81731288-81731310 CCCCTGAACTAAGATCACTGCTA 0: 1
1: 0
2: 1
3: 7
4: 112
Right 957553033 3:81731334-81731356 TGATTTTCTTGTTTCACATTAGG 0: 1
1: 0
2: 2
3: 62
4: 587

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
957553029 Original CRISPR TAGCAGTGATCTTAGTTCAG GGG (reversed) Intronic
901693440 1:10989299-10989321 TATGAGTGATCTCAGTACAGGGG - Intergenic
902069995 1:13726233-13726255 TAGCACAGATCTTGGCTCAGAGG + Intronic
903777628 1:25803005-25803027 TAGCAGTGATCACAGGTCACCGG - Intronic
904986145 1:34550188-34550210 CAGCAGTGATGTTAGTGCAGGGG - Intergenic
907055789 1:51366648-51366670 TAGCAGTGATTTAAGTTCATAGG - Intronic
915948664 1:160172947-160172969 TTGCAGAGCTCTCAGTTCAGTGG + Intronic
916042259 1:160971329-160971351 TTGCAGTGAACTGAGTGCAGTGG - Intergenic
917515421 1:175703378-175703400 TAGCACAGTTCTTGGTTCAGAGG + Intronic
917872943 1:179257924-179257946 TAGCTGTTTTCTTAGCTCAGTGG + Intergenic
920727090 1:208446156-208446178 TAGCAGTGTGCTTCCTTCAGAGG + Intergenic
921709867 1:218363199-218363221 TAGCAGGGACCTTATTTCTGGGG + Intronic
922222613 1:223619920-223619942 AAGCAGTGCTCTCAGTTCATTGG + Intronic
924392758 1:243580979-243581001 ATGCAGAGATCTTAGTGCAGGGG + Intronic
924683260 1:246259980-246260002 ATGCAGAGATCTTGGTTCAGGGG - Intronic
1065487725 10:26250786-26250808 TAGCGATGATCTTTGTACAGTGG - Intronic
1071005680 10:80881835-80881857 TAGCAGTGAGCTAGGCTCAGTGG - Intergenic
1074203436 10:111259774-111259796 TAGCAGAGATCTGTGTTAAGAGG + Intergenic
1075040951 10:119106131-119106153 TTGCAGTGAGCTGAGATCAGAGG + Intronic
1081727703 11:45342879-45342901 TTGCAGTGAGCCTAGATCAGCGG - Intergenic
1084149888 11:67283153-67283175 CAGCAGGGAGCGTAGTTCAGGGG - Exonic
1085011878 11:73146954-73146976 TAGCAGAGATCTAAGGCCAGAGG + Intergenic
1086758571 11:90596829-90596851 TAGCAGTGATCAAACATCAGAGG + Intergenic
1089429439 11:118410111-118410133 TAGCAGTGTTCTAAATGCAGTGG - Intronic
1089766588 11:120771963-120771985 TGGCAGTGATTCTAGTCCAGAGG + Intronic
1092562861 12:9634698-9634720 TAGCTCTGCTCTTAGTTGAGTGG + Intergenic
1098142280 12:67462369-67462391 TAGCAGTAATTTTAATTAAGAGG + Intergenic
1107529358 13:41266932-41266954 TTGCAGTGAGCTGAGATCAGGGG + Intergenic
1108374267 13:49798661-49798683 TAGCAGTGCTCTTACCTCAGTGG + Intergenic
1110118653 13:71852535-71852557 AAGCTGTGATCCTAATTCAGAGG + Intronic
1114397644 14:22381302-22381324 TAGCTGTGATCTTACTGCTGGGG + Intergenic
1115723889 14:36192224-36192246 TAGCAATGCTTTTGGTTCAGAGG + Intergenic
1127069978 15:55279392-55279414 TTGCAGAGATCCTAATTCAGAGG - Intronic
1133922818 16:10169265-10169287 TAGCATTGCACTTAGTTCCGAGG - Intronic
1134884423 16:17777072-17777094 TAGCAGTGAAGCTATTTCAGAGG - Intergenic
1136171469 16:28492241-28492263 GAGCCGTGACCTTAGATCAGTGG + Intronic
1136931197 16:34419370-34419392 TAACAGAGATCTAAGTGCAGAGG - Intergenic
1136973376 16:34992449-34992471 TAACAGAGATCTAAGTGCAGAGG + Intergenic
1141401568 16:83751641-83751663 TAGCAGGTATCTTAGTTGATGGG + Intronic
1141499663 16:84435209-84435231 TAGAAGTGATCTGATTTCAGAGG - Intronic
1142307270 16:89292814-89292836 TAGCAGTGAGCTTGGGTCACAGG + Intronic
1143924877 17:10360790-10360812 TACCAGTCATATTAGATCAGGGG - Intronic
1158330870 18:56360644-56360666 AAGCAGTCATTTTACTTCAGTGG - Intergenic
1158669934 18:59465294-59465316 GAGCATTGATATTAGTTTAGGGG + Intronic
1160801555 19:972579-972601 ATTCAGTGATCTTGGTTCAGGGG - Exonic
1161757987 19:6148759-6148781 TAGCCATGTTCTTAGTTCCGTGG + Intronic
1165140731 19:33698579-33698601 GGGCAGTGGTCTTGGTTCAGGGG + Intronic
1166643552 19:44514331-44514353 TAGCTGTGTTCTTAACTCAGTGG - Intronic
926933652 2:18065387-18065409 TAGCAGGGGAATTAGTTCAGAGG - Intronic
933262290 2:80144176-80144198 CAGTAGTGATATTAGTGCAGCGG + Intronic
935047396 2:99494425-99494447 TAGTAGTGGTCTTAGGACAGAGG + Intergenic
936065501 2:109329030-109329052 AGGCAGTCATCTTAGTCCAGTGG + Intronic
936836257 2:116712785-116712807 CAGCAGTGTTCTTGGTTTAGTGG + Intergenic
940445365 2:153771046-153771068 TTGCAGAGATGTTAGTGCAGTGG - Intergenic
942065073 2:172263190-172263212 TAGGATTGATCTTATTTCTGGGG + Intergenic
943059069 2:183018872-183018894 CAGCAGTAAAGTTAGTTCAGAGG - Intronic
943711440 2:191099910-191099932 TAGTGGTTATCTTATTTCAGTGG + Intronic
945982030 2:216320095-216320117 TTACAGTAATCTTAGTTCTGTGG - Intronic
946918915 2:224557757-224557779 TAACAGTGGTCTTAGTTTTGAGG - Exonic
1168874114 20:1158748-1158770 TAGCAGGGGTTTGAGTTCAGAGG + Intronic
1170138115 20:13098040-13098062 TAAAAGTGTTCTTAGTTCACAGG - Intronic
1172808837 20:37632823-37632845 TAGTAGTGATCGCAGTTCCGTGG - Intergenic
1173438966 20:43058163-43058185 TACCAGGGATCTAAGTTGAGAGG - Intronic
1181361427 22:22340351-22340373 TGGTAGTTATCTTTGTTCAGTGG - Intergenic
1182183041 22:28371641-28371663 TTGCAGTGAGCTGAGATCAGTGG - Intronic
949746405 3:7298412-7298434 TACCAATGATATTACTTCAGAGG - Intronic
957553029 3:81731288-81731310 TAGCAGTGATCTTAGTTCAGGGG - Intronic
957617009 3:82542791-82542813 TAGCATTGACCTTACTTCAATGG - Intergenic
958542158 3:95492049-95492071 AATCAGTGATGTGAGTTCAGAGG - Intergenic
959129508 3:102336817-102336839 TTGCAGTGATAGTAGATCAGTGG + Intronic
960232776 3:115247795-115247817 TTGCATTGATCTTTTTTCAGGGG + Intergenic
960486232 3:118256133-118256155 TAGCAGTGAGTGAAGTTCAGGGG - Intergenic
960689148 3:120325840-120325862 TTTCAGTGATTTTATTTCAGGGG + Exonic
966806813 3:183814357-183814379 TAGCAGTGATTATCTTTCAGAGG - Intergenic
970377895 4:15477638-15477660 AGGGAGTGTTCTTAGTTCAGGGG - Intronic
972833483 4:42840859-42840881 TAGCATTGTGCTAAGTTCAGAGG - Intergenic
975551812 4:75620750-75620772 TAGCAGTGATTGACGTTCAGGGG + Intronic
977791720 4:101112829-101112851 TAGCAGTGGTTATATTTCAGTGG - Intronic
978219104 4:106247875-106247897 TAGCAATGAACTTGGATCAGTGG - Intronic
982407211 4:155033854-155033876 GTGCAGAGATCTTAGTTCTGAGG + Intergenic
982887460 4:160799395-160799417 TAGCAGTGATGACATTTCAGAGG + Intergenic
983133153 4:164046968-164046990 TGGCAGTGATCTTAGTCCTATGG - Intronic
985282965 4:188305156-188305178 TAAAAATGTTCTTAGTTCAGAGG - Intergenic
985814522 5:2116724-2116746 CTGCAGTGATCATAGTTCACAGG - Intergenic
986092007 5:4518763-4518785 TGGCAGTGACATTAGTTCAGAGG - Intergenic
989325695 5:40191410-40191432 TAGCTGTGTTGTTATTTCAGAGG + Intergenic
990078417 5:51880701-51880723 TAGAAGGGATTTTTGTTCAGTGG + Intergenic
993324692 5:86518696-86518718 TTTCAGTGATTTTATTTCAGGGG - Intergenic
994198758 5:96949021-96949043 TAGCAGTGGTCTAAGATAAGTGG + Intronic
997503310 5:134395915-134395937 TAGCAGAGATCTTTGGTCATAGG + Intergenic
997783696 5:136686049-136686071 GTGCAGTGATCTTGGTGCAGGGG + Intergenic
1001332450 5:170771999-170772021 GAGCAGTGGCCTTAGGTCAGGGG - Intronic
1001756651 5:174175442-174175464 TACCAGTCATATTGGTTCAGGGG + Intronic
1004120332 6:12815422-12815444 TAGCAGTGATCTGGCTTCAGAGG - Intronic
1008092469 6:47307936-47307958 GAACACTGATCCTAGTTCAGTGG - Intronic
1008481512 6:51990639-51990661 TAGCATTGCTCTTATTTCACTGG + Intronic
1008601760 6:53102911-53102933 AAGCAGAGATATTAGTTCAAGGG + Intergenic
1010028515 6:71246843-71246865 TGGCAGTGACAGTAGTTCAGTGG - Intergenic
1015023206 6:128502203-128502225 TAGCAGTGCTCTAAGTTAACAGG + Intronic
1015303028 6:131675772-131675794 TTGCAGTGAGCTGAGATCAGGGG + Intronic
1016360214 6:143259688-143259710 TAGCAGTGAACTAAGTTTGGGGG - Intronic
1017462585 6:154665331-154665353 TAACAGTCATCTTAGGTCAGTGG - Intergenic
1026641429 7:72129523-72129545 TAGGAGTGATATTGGTTCTGTGG + Intronic
1026663726 7:72324245-72324267 AAGCAGAGATTTTAATTCAGTGG - Intronic
1027892648 7:83996059-83996081 TTGCAGTGCTCTTAGGACAGTGG - Intronic
1031029147 7:116715779-116715801 TAGCAGAGAACTTGGGTCAGGGG - Intronic
1031904607 7:127446935-127446957 GTGCAGAGATCCTAGTTCAGGGG + Intergenic
1037249801 8:16878651-16878673 TAGCAGTGATCGAGGTTCTGTGG - Intergenic
1041401408 8:57449107-57449129 TAAAAGTGATCTTATTTAAGAGG + Intergenic
1041831724 8:62162260-62162282 TAGCAGTGATCTTCTTTTGGTGG - Intergenic
1045124205 8:99071885-99071907 TACCAGTGATGTTCATTCAGGGG + Intronic
1047501578 8:125445812-125445834 TGACCTTGATCTTAGTTCAGGGG + Intergenic
1047715302 8:127589772-127589794 TAGCACTGAGCTCAGTACAGAGG - Intergenic
1050138191 9:2490400-2490422 AAGCAGTGATCTAGGCTCAGGGG + Intergenic
1051978104 9:22979092-22979114 TAGCAATGAGCTTAGTTCCTAGG + Intergenic
1052353030 9:27476486-27476508 TAGCAGTCATTTTAGATTAGAGG + Intronic
1053122451 9:35557158-35557180 TAAAAATGTTCTTAGTTCAGTGG - Intronic
1055013948 9:71595893-71595915 TAGCAGTGATCGAGGTTCCGTGG - Intergenic
1057380434 9:94562417-94562439 TATCAGTGTTCTTAGTTCAGTGG + Intronic
1188253460 X:27928864-27928886 TATCAGTACTCTTAATTCAGTGG - Intergenic
1191674649 X:63782189-63782211 TGACACTGATCTAAGTTCAGGGG - Intronic
1201364275 Y:13186391-13186413 TAGCAGTGAGCACAGTTCCGTGG - Intergenic