ID: 957553449

View in Genome Browser
Species Human (GRCh38)
Location 3:81735969-81735991
Sequence TAGTAGGCTTAGATGTGGAG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 105
Summary {0: 1, 1: 0, 2: 1, 3: 6, 4: 97}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
957553449 Original CRISPR TAGTAGGCTTAGATGTGGAG TGG (reversed) Intronic
901592316 1:10355486-10355508 CAGTAGGTTTACATGGGGAGGGG - Intronic
902256729 1:15193953-15193975 TAGTTGGCTTAGCAGTAGAGTGG - Intronic
911139363 1:94482089-94482111 CCATAGGCTTAGGTGTGGAGAGG + Intronic
913515692 1:119603707-119603729 TACGAGGCTTGGAGGTGGAGTGG + Intergenic
914395362 1:147261829-147261851 TATTGGGCTGAGATGGGGAGGGG + Intronic
916933578 1:169604832-169604854 CAGCAGGGGTAGATGTGGAGGGG + Intronic
918131482 1:181633445-181633467 TGGTAGGCAGAGAGGTGGAGAGG + Intronic
1064594715 10:16932006-16932028 AGGAAGGCTTAGATGTGAAGAGG + Intronic
1064676135 10:17762216-17762238 TAGCAGACTGAGATGTGGCGTGG - Intronic
1066128690 10:32368332-32368354 GAGTAGGCTATGATGTGCAGAGG - Intronic
1068700652 10:60016156-60016178 TAGAAGACTTGAATGTGGAGAGG + Intergenic
1068895175 10:62190960-62190982 TAGTAGTCATAGAAGTGGAAAGG - Intronic
1069026580 10:63549242-63549264 TAGAAGGCAGAGGTGTGGAGTGG + Intronic
1070600322 10:77861786-77861808 TAGGAGGCATTGTTGTGGAGTGG - Intronic
1070643828 10:78187669-78187691 TAAAAGGCTTAGATGAGGAAGGG - Intergenic
1071105388 10:82087828-82087850 TAATAGGCTGAGACCTGGAGTGG - Intronic
1071725487 10:88194195-88194217 GAGAAGGCTTTGTTGTGGAGGGG + Intergenic
1076329096 10:129652086-129652108 GTGTAGGAGTAGATGTGGAGGGG + Intronic
1076643942 10:131938516-131938538 TAGCAGGCTGAAATGGGGAGGGG - Intronic
1081321960 11:41702386-41702408 GAGTAGAAATAGATGTGGAGAGG - Intergenic
1093029764 12:14277455-14277477 TACTAGGCTTAGAAGTTGAGTGG - Intergenic
1100412115 12:94330193-94330215 TAGTAGCATTTGTTGTGGAGAGG - Intronic
1101618787 12:106363327-106363349 TAGCAGGTTTAGGTGTGGAGGGG - Intronic
1101827711 12:108233323-108233345 TTGTCGACTTAAATGTGGAGAGG - Intronic
1102431883 12:112890241-112890263 TCAGAGGCTTAGGTGTGGAGAGG - Intronic
1103466003 12:121142388-121142410 TAGCAGGCTTGGAGATGGAGAGG - Intronic
1105440531 13:20412078-20412100 TGGGAGGTTTAGATGTTGAGAGG - Intronic
1105650439 13:22371699-22371721 TTGTAGGCTTATAGGTGGAAGGG - Intergenic
1111291731 13:86180036-86180058 CAGTAGGGTAAGATGTGGAGGGG + Intergenic
1111328506 13:86731555-86731577 TAGAATGCTCAGATGTGAAGTGG - Intergenic
1116590518 14:46765562-46765584 TAGTGGGACAAGATGTGGAGTGG - Intergenic
1119580689 14:75777136-75777158 TAATTGGCTAAGATATGGAGAGG - Intronic
1120649974 14:87120230-87120252 GAGTAGGCTCAGGAGTGGAGAGG + Intergenic
1121066315 14:90969716-90969738 TAGAAAGCTTAGATGTCTAGAGG - Intronic
1121515387 14:94546249-94546271 TAGAAGGCTGAGATCTGGAAAGG - Intergenic
1124171575 15:27378345-27378367 GAGTAGGCCCAGATATGGAGTGG + Intronic
1124687410 15:31794023-31794045 AAGAAGGCTTAGATGTAGAAGGG - Intronic
1124896856 15:33785523-33785545 CAGTGAGCTTGGATGTGGAGTGG - Intronic
1124932039 15:34129971-34129993 TATTAGGCTCAGCAGTGGAGGGG - Intergenic
1125322595 15:38504531-38504553 CAATAGGATAAGATGTGGAGTGG - Intronic
1125598254 15:40901061-40901083 CAGTAGCTTTAGATGTGGAAGGG + Intronic
1135055269 16:19226803-19226825 TTGTAAGCTTAGATGAGGAGAGG + Intronic
1136683770 16:31982467-31982489 GAGCAGGCTCTGATGTGGAGTGG + Intergenic
1136784398 16:32926023-32926045 GAGCAGGCTCTGATGTGGAGTGG + Intergenic
1136885385 16:33927783-33927805 GAGCAGGCTCTGATGTGGAGTGG - Intergenic
1137921104 16:52489343-52489365 TAGGAGGCTTAAAGGTGAAGGGG - Intronic
1203087057 16_KI270728v1_random:1190029-1190051 GAGCAGGCTCTGATGTGGAGTGG + Intergenic
1142605453 17:1078733-1078755 GAGTGGGCTTAGATGTGGCCGGG - Intronic
1149173664 17:53843936-53843958 TAGGAGCCTTAGATTTTGAGAGG + Intergenic
1149318671 17:55462834-55462856 TATGAGCCTCAGATGTGGAGAGG + Intergenic
1156517194 18:37690341-37690363 CAGTAGGACAAGATGTGGAGGGG + Intergenic
1158225166 18:55193362-55193384 TAGTAGGCTGTGATGTGTATGGG - Intergenic
1159401796 18:67947153-67947175 TATTAGGCATATATGTGGATTGG - Intergenic
1165495268 19:36149028-36149050 TGTTAGGCTTAGAACTGGAGAGG + Intronic
1167736115 19:51295558-51295580 TCAGAGGCATAGATGTGGAGGGG + Intergenic
929377437 2:41306208-41306230 TTGTAGTTTTACATGTGGAGTGG - Intergenic
934537365 2:95146491-95146513 TTGCAGGCTGAGATGTGGAAAGG + Intronic
936792439 2:116165416-116165438 TGACAGGCTTAGAGGTGGAGGGG + Intergenic
939513802 2:143141127-143141149 TGGCAGCTTTAGATGTGGAGAGG + Intronic
939679848 2:145116947-145116969 AAGTATGCATAGATTTGGAGGGG - Intergenic
945659130 2:212663492-212663514 TTGTAAACTTAAATGTGGAGAGG - Intergenic
1172295237 20:33805335-33805357 CAGACTGCTTAGATGTGGAGGGG + Intergenic
1172433894 20:34914773-34914795 TACTAGGCTGTGATGTGGGGTGG + Intronic
1174163485 20:48568151-48568173 TAGGGGGCTTAGATGGGGAAGGG + Intergenic
1177622510 21:23614734-23614756 TAGTAGGCTTATATGTTTATGGG + Intergenic
1203298215 22_KI270736v1_random:58801-58823 TGGAATGCTTTGATGTGGAGTGG + Intergenic
949588384 3:5466273-5466295 TAGAAGGCTAAGATTTGGAGAGG + Intergenic
957553449 3:81735969-81735991 TAGTAGGCTTAGATGTGGAGTGG - Intronic
959884624 3:111485059-111485081 TAATAGGAATAAATGTGGAGAGG - Intronic
966824681 3:183953647-183953669 TATTTGGCTTAGGTGTGGGGTGG + Intronic
974687982 4:65256117-65256139 TGGTTGGCTAAGGTGTGGAGAGG + Intergenic
976196832 4:82540353-82540375 TAGGAGGCTGAGGTGTGGGGAGG - Intronic
976213615 4:82694766-82694788 GAGTAGGCTGAGAGGAGGAGGGG + Intronic
977432063 4:96942479-96942501 TAGTAGGCAAAGATGTAGTGAGG - Intergenic
977537404 4:98270820-98270842 GAGTAGGCTGAGAAGAGGAGGGG - Intronic
981332224 4:143524569-143524591 TAGTAGTCTTAGATGTTTATTGG + Intronic
986021961 5:3812828-3812850 TAGAAGGCTTTGCTGTGGGGTGG + Intergenic
987184869 5:15406905-15406927 TAGGAGGCTCACATATGGAGAGG - Intergenic
991092341 5:62705370-62705392 TAGAAGGCTGAGATGAGGATAGG + Intergenic
991547583 5:67800489-67800511 AAGAAGGCTTACACGTGGAGAGG + Intergenic
992248462 5:74853407-74853429 GAGGAGCCTCAGATGTGGAGAGG + Intronic
996637274 5:125708629-125708651 TAGTAGGCTTAGAGTAGTAGCGG + Intergenic
999231590 5:150065194-150065216 CAGCAGGCCTAGATGGGGAGGGG - Intronic
1001223742 5:169926170-169926192 TAGTCGGCATGGATGTGGATAGG + Intronic
1003891874 6:10570875-10570897 TACAAGGCTTAGAAGTGGGGAGG - Intronic
1005398022 6:25404097-25404119 GAGTAATCTTAGAAGTGGAGGGG - Intronic
1009381128 6:63031456-63031478 CAGTAGTCTTAGTTGTGGATGGG + Intergenic
1010768462 6:79802421-79802443 TAGAAGCCTGAGATCTGGAGTGG - Intergenic
1011483300 6:87816557-87816579 TAGTGTGCTTAGTTGTGGATAGG + Intergenic
1013187177 6:107769816-107769838 TAGTAGCCTTAGATTTGGAGGGG - Intronic
1014928141 6:127299327-127299349 CAGTGGGGTAAGATGTGGAGGGG + Intronic
1015942691 6:138467606-138467628 CAGTAGGACAAGATGTGGAGGGG + Intronic
1016776390 6:147909214-147909236 AACTAGGCCTTGATGTGGAGGGG + Intergenic
1030032846 7:105385511-105385533 TTGGAGGCTTACATGTGGAAGGG - Intronic
1032976241 7:137226582-137226604 CAGTTGGCTTTGATGTAGAGGGG + Intergenic
1037500433 8:19480386-19480408 TAGTTTGCTTAGAGCTGGAGTGG + Intronic
1043993223 8:86781235-86781257 TTATAGGCTTATATGTGGAAGGG + Intergenic
1048985652 8:139733431-139733453 TAGCAGGCTAAGATGTGGGGTGG + Intronic
1057303475 9:93899617-93899639 TGGGAGACTGAGATGTGGAGAGG - Intergenic
1058240286 9:102548864-102548886 TTGTAGGCTTATAGGTGGAAGGG + Intergenic
1059223257 9:112646119-112646141 TAGTAGAATTAGATGAGGACGGG + Intronic
1192834410 X:74783950-74783972 TTGTATGCTAGGATGTGGAGGGG - Intronic
1192965846 X:76175899-76175921 CAGAAGGCTTGGATGGGGAGTGG + Intronic
1199604228 X:149563793-149563815 TAGTAGAGTTAGTGGTGGAGAGG + Intergenic
1201484531 Y:14478231-14478253 CTGGAGGCTTATATGTGGAGGGG - Intergenic