ID: 957553558

View in Genome Browser
Species Human (GRCh38)
Location 3:81736960-81736982
Sequence ATGGAGTAGTAGAAGCAGGA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 432
Summary {0: 1, 1: 0, 2: 3, 3: 37, 4: 391}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
957553553_957553558 28 Left 957553553 3:81736909-81736931 CCTTTTTAGAAAACTCATTCTTG 0: 1
1: 0
2: 1
3: 62
4: 442
Right 957553558 3:81736960-81736982 ATGGAGTAGTAGAAGCAGGAAGG 0: 1
1: 0
2: 3
3: 37
4: 391

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
957553558 Original CRISPR ATGGAGTAGTAGAAGCAGGA AGG Intronic
900149084 1:1170500-1170522 ATGGAGGAGAGGAAGGAGGAGGG - Intergenic
900364116 1:2303832-2303854 TTGTAGGAGTAGAAGCTGGAGGG - Exonic
900868906 1:5287977-5287999 ACCGAGTAGCAGAAGGAGGAAGG - Intergenic
903404867 1:23087903-23087925 ATGGAGAAGGAGGAACAGGAGGG + Exonic
903481093 1:23653957-23653979 ATGCTCTAGTAGAACCAGGAGGG + Intergenic
905476125 1:38229408-38229430 ATGGAGTAGGAAAGGCAGGCAGG + Intergenic
906180896 1:43817827-43817849 AAGGAGAAGAAGAAGGAGGAAGG - Intronic
906794804 1:48688352-48688374 ATGGAGATGAGGAAGCAGGAAGG - Intronic
907184506 1:52599618-52599640 ATGGGGAAGAAGGAGCAGGATGG + Intergenic
907684840 1:56600508-56600530 CTGGAGTAGCAGCAGCAGGAAGG + Intronic
907787286 1:57625240-57625262 CAGGAGTAGAAGAAGGAGGAGGG - Intronic
908539958 1:65112869-65112891 ATTGAGAAGTAGGACCAGGATGG + Intergenic
908858780 1:68459794-68459816 ATGGGGTAGAAGAAGCAGGGTGG + Intergenic
909344887 1:74573169-74573191 AGGGAGCAGCAGAAGCAGAAGGG - Exonic
909584467 1:77274153-77274175 ATGGAGTACTAGAATAAGAATGG - Intergenic
912449668 1:109761214-109761236 AGGAAGAAGTAGCAGCAGGATGG - Intronic
913717912 1:121557203-121557225 ATTGAGGAATAGAAGCAGGAAGG - Intergenic
914925986 1:151888125-151888147 AGGGAGTGGGAGAAGCAGGACGG - Intronic
914992178 1:152508331-152508353 GTGGAGAAGTATAAGCAAGAAGG - Intergenic
915075112 1:153301800-153301822 ATGGAGTAGAAGAAGCTGCTTGG - Intronic
915360516 1:155283913-155283935 ATGGAGGAGGACAAGCAGGGAGG + Intronic
915631874 1:157159105-157159127 AAGAAGTGGTGGAAGCAGGAAGG - Intergenic
915713043 1:157919613-157919635 GTGGGGAAGCAGAAGCAGGAGGG - Intergenic
916214361 1:162383098-162383120 TTGGAGTTGGAGAAGCAAGATGG + Intronic
916635425 1:166662749-166662771 ATGGAGTAGAAGATGGAAGAAGG - Intergenic
916654118 1:166858259-166858281 AGGGAGCAGTAAAAGCTGGAGGG + Exonic
917539083 1:175896238-175896260 ATGAAATATTACAAGCAGGATGG + Intergenic
917965688 1:180177108-180177130 ATTGAGAAATAGAAGCAGCAAGG - Intronic
919367132 1:196675818-196675840 AAGGAGGAGGAGAAGGAGGAAGG + Intronic
919434826 1:197544954-197544976 AGGGAGAAGGAGAAGGAGGAAGG + Intronic
919796668 1:201325214-201325236 ATGGAGTAGGGGAAGCACCAAGG + Intronic
919940738 1:202284279-202284301 AAGGAGTTGTGGATGCAGGATGG - Intronic
920019675 1:202945849-202945871 ATGGAGACTTAGAAGCGGGAGGG + Intronic
920070781 1:203301510-203301532 AGGGAGAAGGAGAAGCAGGAAGG + Intergenic
920084927 1:203408523-203408545 TGGGAGTAGTAGTAGGAGGAGGG + Intergenic
920106811 1:203559213-203559235 ATATAGAAGTAGAAGAAGGAGGG + Intergenic
920160838 1:203996665-203996687 TGGGAGAAGGAGAAGCAGGATGG + Intergenic
921030439 1:211331296-211331318 ATGGTGTAGTAGAAACAGTGTGG + Intronic
921418584 1:214919808-214919830 ATGGAGAAGGAGAATCAGGAAGG - Intergenic
922027710 1:221767137-221767159 CAGGAGTAGGAGAGGCAGGAGGG - Intergenic
922030955 1:221797667-221797689 ATGGAGTGGGAGAAAGAGGAAGG + Intergenic
922544019 1:226441734-226441756 ATGGAGAAGGCGAGGCAGGAAGG + Intergenic
922662972 1:227446486-227446508 TAGAAGGAGTAGAAGCAGGAGGG + Intergenic
922755349 1:228093554-228093576 ATGGAATGGCAGAACCAGGATGG - Intronic
923638051 1:235721241-235721263 ATGGTGTAGTAGAAACAGCACGG + Intronic
923760018 1:236833595-236833617 AGGGGGCAGTAGAAACAGGAAGG + Intronic
1063866946 10:10374912-10374934 ATGGAGATGGAAAAGCAGGAAGG + Intergenic
1064138995 10:12774428-12774450 AGGGAGCAGGGGAAGCAGGAAGG + Intronic
1065795941 10:29308408-29308430 ATGGGGTGGAGGAAGCAGGATGG - Intronic
1066169710 10:32828413-32828435 AAGGAGAAGAAGAAGAAGGAAGG + Intronic
1066761417 10:38757077-38757099 TTGGGGTAGTAGAAAAAGGAAGG + Intergenic
1066995261 10:42556833-42556855 TTGAAGTCTTAGAAGCAGGAAGG - Intergenic
1068306096 10:55210528-55210550 ATGGTGTAGTTGAAGCATGGAGG + Intronic
1068934466 10:62622399-62622421 AGGGAAAAGGAGAAGCAGGATGG - Intronic
1070001634 10:72382493-72382515 ATACAGTATTAAAAGCAGGAAGG + Intronic
1070267983 10:74923221-74923243 AAGGAGTAGGAGAAGTAGAAGGG + Intronic
1070313072 10:75287702-75287724 ATGGAGCAGCAGAATGAGGAGGG - Intergenic
1071110774 10:82152766-82152788 AAGGAGAAGGAGAAGAAGGAAGG - Intronic
1072160557 10:92762290-92762312 TTGAAGAAGTTGAAGCAGGAAGG - Intergenic
1073046534 10:100642383-100642405 ATGGAGGAGGGGAAGCAGGGAGG + Intergenic
1073542132 10:104323112-104323134 GTGGAGTAGAAGAGGCAGGCTGG + Intronic
1074162710 10:110847174-110847196 ATTCAGTGGAAGAAGCAGGATGG - Intergenic
1074412841 10:113243042-113243064 ATGGATACGTGGAAGCAGGAGGG + Intergenic
1074717918 10:116236680-116236702 ATGGAGTTGAAGAAGGAGAATGG + Intronic
1074732174 10:116390825-116390847 AAGGAGAAGAAGAAGAAGGAAGG + Intergenic
1076831868 10:132999426-132999448 ATGGAGGTGGAGAAACAGGAGGG - Intergenic
1076831894 10:132999514-132999536 ATGGAGGTGGAGAAACAGGAGGG - Intergenic
1076831920 10:132999602-132999624 ATGGAGGTGGAGAAACAGGAGGG - Intergenic
1076867610 10:133175752-133175774 ATGGATTAGTAGAGGATGGACGG + Intronic
1076939261 10:133590750-133590772 GTGGAGCAGAAGATGCAGGAAGG - Intergenic
1078060685 11:8040703-8040725 AAGGAGCAGTAGGAGGAGGAGGG + Intronic
1078850141 11:15156126-15156148 ATGGATTTGTAGCAGCAGCAGGG - Intronic
1080453690 11:32399687-32399709 ATGGAGCAGTAAAGGCAGAAAGG + Intronic
1081559645 11:44201775-44201797 CTGGAGCAGTAGAAGGAGAAGGG - Intronic
1082743676 11:56939201-56939223 ATGGAGTGGGAGAAGTAGGGAGG - Intergenic
1082892418 11:58154159-58154181 AAGGAGGAGGAGAAGGAGGAGGG + Intronic
1082979337 11:59105552-59105574 ATGGAGGATTTGAAGCAGGGGGG - Intergenic
1083489201 11:63002648-63002670 GTGGAGTAGGAGAGGGAGGAAGG - Intronic
1084502741 11:69544517-69544539 AAGGAGGAGGAGAAGCAGGCAGG + Intergenic
1084712711 11:70853811-70853833 ATGGAGTGGAAGAGGCAGGGAGG - Intronic
1086182711 11:83973607-83973629 ATGCAGTGGTAGCAGCAGAATGG + Intronic
1086414710 11:86577024-86577046 CTGTTGTGGTAGAAGCAGGATGG + Intronic
1087147406 11:94825741-94825763 ATGGAGTAATAGAAAGAAGAAGG + Intronic
1087539186 11:99493059-99493081 AGGTAGCAGTAGAAGCAGGAAGG - Intronic
1088707373 11:112475929-112475951 ATCGATTAGAAGCAGCAGGAAGG - Intergenic
1089965884 11:122655060-122655082 AAGGAGGAGGAGAAGAAGGAAGG - Intergenic
1091166598 11:133481826-133481848 ATGGAGGAGTACAGGAAGGAGGG + Intronic
1092260697 12:6951930-6951952 GTGCAGGAGTAGAGGCAGGAGGG - Intronic
1092991149 12:13900799-13900821 ATAGAGTAAAAGAAGCAAGAGGG - Intronic
1095633847 12:44408195-44408217 ATGTAGTAATAGAAGCAGCAAGG - Intergenic
1095779866 12:46047860-46047882 ATGTAGTAAAAGAAACAGGAGGG + Intergenic
1096156577 12:49344823-49344845 CTGGAGTAGGAGAAGGAGGAGGG + Intergenic
1096528423 12:52228139-52228161 AAGGAGAAGAAGAAGGAGGAGGG - Intergenic
1098987903 12:77031939-77031961 ATGGAGAAGTTGAAGGTGGATGG - Intronic
1099473296 12:83076773-83076795 AGGGAGAATTAGAAGCAGGAGGG - Intronic
1100855504 12:98753935-98753957 ATGGAGAGGAAGATGCAGGATGG + Intronic
1101541627 12:105670780-105670802 ATGGAGTATGAGAAGGAGGTAGG - Intergenic
1101572047 12:105962646-105962668 AAGAAGTAGTAGAAGCAGTAAGG + Intergenic
1102487307 12:113266940-113266962 ATGAAGAAGGAGAAACAGGAAGG - Intronic
1102651693 12:114447085-114447107 AGGGAGTTGTCGATGCAGGATGG - Intergenic
1103040542 12:117691617-117691639 ATGGAGAACTGGAGGCAGGAGGG - Intronic
1103525150 12:121562646-121562668 ATGGAGGAGGAGGAGGAGGAAGG + Intronic
1104196909 12:126549085-126549107 ATGAAGGAGGAGAAGAAGGATGG + Intergenic
1104531379 12:129574192-129574214 ATGGATTAATAGATGCAAGAAGG + Intronic
1104830462 12:131747451-131747473 ATGAGGTAGGAGAAGCAGGCAGG + Intronic
1106505014 13:30363677-30363699 ATGGTGTAGGAGAAAAAGGATGG - Intergenic
1106625673 13:31418642-31418664 ATGCAGTAATAGAACCAGGAAGG - Intergenic
1107000205 13:35535265-35535287 ATTGTGTAGTTGAAGCATGAAGG + Intronic
1108892956 13:55284703-55284725 AAGGAGGAGGAGAAGGAGGAGGG + Intergenic
1109918508 13:69023817-69023839 AAGAAGTAGTAGAAACAGGAAGG - Intergenic
1110717967 13:78729689-78729711 CTGGAGTAATAGAAGCTGGAGGG - Intergenic
1111350830 13:87028768-87028790 ATGGAATAGTAGAATGTGGATGG + Intergenic
1111616087 13:90663424-90663446 ATGAAGTAACCGAAGCAGGAAGG - Intergenic
1112872793 13:103995385-103995407 ATGGGGTAGGAGAAGCAGGGAGG - Intergenic
1114961827 14:27901475-27901497 TTGGAGTAGGAAAAGCAGAAAGG + Intergenic
1115275589 14:31605751-31605773 AAGGAGAAGGAGAAGGAGGAAGG - Intronic
1115828242 14:37301749-37301771 TTTGAGTAGAAGAAGCAGTAGGG - Intronic
1116039953 14:39674003-39674025 ATGGAGTAGTAGGATGAGCATGG - Intergenic
1117671948 14:58117057-58117079 CTGGAGAAGTGGAGGCAGGAGGG - Intronic
1117972037 14:61261296-61261318 AGGGAATAGTTGAAGCAGCATGG + Intronic
1118909421 14:70048979-70049001 ATGACGTAGTCAAAGCAGGAGGG + Exonic
1119071869 14:71594057-71594079 ATGGAGGAGGAGGAGAAGGAAGG - Intronic
1119674986 14:76546897-76546919 ATGGAGTAGTAGCAGCTGTCAGG - Intergenic
1121080438 14:91103515-91103537 ATGCAGAAGTAGATGTAGGAAGG - Intronic
1121382254 14:93482955-93482977 ATGTAGTAATTGAAACAGGAAGG - Intronic
1121519987 14:94579463-94579485 ATGTGATGGTAGAAGCAGGAAGG - Intronic
1121662702 14:95647234-95647256 GTGGAGGAGTAGAAGGAGGAGGG + Intergenic
1121929709 14:97961225-97961247 TTGGAGTACTGGAAACAGGAGGG + Intronic
1122556482 14:102583503-102583525 CTGGAGCAGTGCAAGCAGGACGG + Intergenic
1122943839 14:104996030-104996052 TTGGAGTGGGAGGAGCAGGATGG - Intronic
1123435298 15:20249785-20249807 AGGGTGTGGTTGAAGCAGGAAGG - Intergenic
1123688748 15:22819582-22819604 TTGCAGTAGTAGAAGTAGTATGG - Intronic
1124417878 15:29489192-29489214 AGGCAGTAGCAGAAGCAGCATGG + Intronic
1124601950 15:31140589-31140611 ATGGAAGAGAAGAAGCAAGAAGG - Intronic
1124637440 15:31374036-31374058 AGGGCTGAGTAGAAGCAGGATGG - Exonic
1126670827 15:51113686-51113708 ATGGGTCAGAAGAAGCAGGAAGG - Intergenic
1126852281 15:52804696-52804718 ATGGAGCCGAAGAAGCTGGAGGG - Intergenic
1126896358 15:53261230-53261252 CTGGAGTAGGAGAAGCAGACTGG + Intergenic
1128121454 15:65150853-65150875 CTGGAGTTGAAGAAGAAGGATGG - Exonic
1128522896 15:68387119-68387141 ATGGAAAAGTAGAAGAAGGTAGG + Intronic
1128859269 15:71051930-71051952 ATGGGGTAGTGGGAGCAGGTAGG - Intronic
1129360622 15:75021703-75021725 AGGAAGTAGAAGAAGCAGGCTGG + Intergenic
1130667442 15:85881568-85881590 AAGGAGTAGTGGAAGGAAGAGGG - Intergenic
1130959842 15:88652423-88652445 AAGGAGGAGGAGAAGGAGGAGGG - Intronic
1130961280 15:88660061-88660083 ATGGAATAGGAGAATGAGGAGGG - Intergenic
1131014192 15:89043665-89043687 AGGGAGGAGGAGAAGGAGGAGGG + Intergenic
1131375597 15:91920451-91920473 ATGGAGTATTGGAGGTAGGATGG + Intronic
1131877470 15:96825803-96825825 AAGCAGCAGCAGAAGCAGGATGG - Intergenic
1132028049 15:98419586-98419608 ATGGAGGAGGAGGAGGAGGAGGG + Intergenic
1132834435 16:1945732-1945754 ATGGAGTGGTGGGAGCAGAAGGG - Intronic
1133546681 16:6814427-6814449 ATTGGGTGGTAGAAGCAGGTGGG + Intronic
1133802041 16:9092045-9092067 ATGGAGGAGCGGAAGGAGGAGGG + Exonic
1135913147 16:26579214-26579236 AAGGAGGAGAAGAAGAAGGAAGG - Intergenic
1136030778 16:27501306-27501328 ATGGATCAGGAGAAGCAGGAAGG - Exonic
1136849315 16:33601205-33601227 AGGGTGTGGTTGAAGCAGGAAGG + Intergenic
1137514004 16:49126704-49126726 ATAGCCTAGCAGAAGCAGGAGGG - Intergenic
1137867816 16:51919042-51919064 ATGGTGTAGTGGAAACAGTATGG - Intergenic
1139299696 16:65934458-65934480 GTGGTGGAGTAGAAGCAGGGCGG - Intergenic
1140357050 16:74315383-74315405 ATGGAGTAGAATAGGGAGGAGGG - Intergenic
1140719700 16:77760296-77760318 ATGAAGTGCTAGAAGCTGGAAGG - Intergenic
1141275545 16:82584645-82584667 ATGGAGAAGAAGAAGAAGTAGGG + Intergenic
1141290249 16:82712025-82712047 ATGGAGTATAAAATGCAGGAAGG - Intronic
1141332735 16:83126959-83126981 ATGAAGGAGTAGAGGGAGGAGGG + Intronic
1141412312 16:83843919-83843941 ATGCACCAGTAGCAGCAGGAAGG + Intergenic
1203111022 16_KI270728v1_random:1449855-1449877 AGGGTGTGGTTGAAGCAGGAAGG + Intergenic
1143055442 17:4158685-4158707 TTGGAGAACTAGAAGCAGCATGG - Intronic
1143859497 17:9878145-9878167 ATTGAGTAGTACAAGCCGGGTGG + Intronic
1143870279 17:9953310-9953332 AAGGAGTGGCAGAAGCAGCAGGG - Intronic
1144201322 17:12944787-12944809 AAGGAGTAGTAATAGCAGCAGGG - Intronic
1145123105 17:20278302-20278324 TTGGAGAATTAGAAGCAAGAGGG + Intronic
1146127451 17:30240035-30240057 ATGGGGTTGTGGAAGCAGCAGGG - Intergenic
1146742552 17:35299223-35299245 ATGGAGAAGGAGAAGGAGCAGGG - Intergenic
1147138761 17:38449984-38450006 CTGGAGGAGTAGAAGCAAGTAGG - Intronic
1148547351 17:48528501-48528523 ATGGAGAAACAGAAGCAGGCAGG + Intergenic
1148641382 17:49190310-49190332 AGGGAGAAGTGGAAGTAGGAAGG + Intergenic
1149000472 17:51752364-51752386 ATGGAGAAGTTGAAGCTGCAGGG + Intronic
1149629893 17:58114063-58114085 ATTGAGTAGAATATGCAGGAAGG - Intergenic
1151542644 17:74772547-74772569 ATGAAGGAGCAGAAACAGGAGGG + Intronic
1151784441 17:76268500-76268522 AGGGAGTAGTGGAGGGAGGAGGG + Intronic
1153235475 18:2982460-2982482 ATGGCATAGTAAATGCAGGAGGG + Intronic
1153509453 18:5835926-5835948 AGGGAGTAGAAGAAGAGGGAAGG + Intergenic
1153979594 18:10297669-10297691 CTGGAGGGGGAGAAGCAGGAAGG - Intergenic
1154098994 18:11451055-11451077 GAGGACTACTAGAAGCAGGAAGG + Intergenic
1154964957 18:21347397-21347419 AAGGAGCAGCAGAAGCAGGAAGG - Intronic
1155063228 18:22247039-22247061 AGGGAGGAGGAGGAGCAGGAGGG + Intergenic
1155066517 18:22273718-22273740 ATGGAGGAGGAGGAGGAGGAGGG - Intergenic
1155416069 18:25601236-25601258 AGGAAAGAGTAGAAGCAGGAAGG - Intergenic
1155610384 18:27660598-27660620 AGAAAGCAGTAGAAGCAGGAAGG - Intergenic
1155787985 18:29926116-29926138 ATGGAGTCTTAGAGGCAAGAGGG + Intergenic
1155789958 18:29953087-29953109 AAGGAGCAGTTGAAGCAGGTGGG - Intergenic
1155882829 18:31170949-31170971 ATGGAGAAGATGAAGGAGGATGG + Intergenic
1155923565 18:31630013-31630035 GTGGAGAAGGAGAAGCAGGAAGG + Intronic
1156078182 18:33305742-33305764 AAGGAGGAGAAGAAGGAGGAGGG - Intronic
1156560542 18:38120591-38120613 ATGGAGGAGTGGAAGCAATATGG - Intergenic
1158248193 18:55455219-55455241 AAGGAGAAGTAGAAGAAGAAAGG + Intronic
1158555513 18:58471519-58471541 ATGGAGGAGGAGCAGCAGGCTGG - Intergenic
1158684303 18:59599079-59599101 AAGTAGTAGTAGAAGAAGAAAGG - Intronic
1159780604 18:72656406-72656428 ATGAAGTTGTAGAAACTGGAAGG - Intergenic
1160057656 18:75499541-75499563 AAGGAGTAGGAGAAGGAGAAGGG + Intergenic
1160816611 19:1038919-1038941 ATGGAGCAGTATAAGCTGGTCGG - Exonic
1161517985 19:4707355-4707377 AGGGAATGGCAGAAGCAGGATGG + Intronic
1162053115 19:8046863-8046885 AAGGAGGAGGAGAAGGAGGATGG - Intronic
1162348834 19:10136920-10136942 GTTGAGTAGTAAAAGCAGGCTGG - Intronic
1162451009 19:10754972-10754994 ATGGACTAGAAGGGGCAGGAGGG - Intronic
1163912233 19:20206520-20206542 TTGAAGAAGTAGAATCAGGAAGG + Intergenic
1163984759 19:20935488-20935510 ATGTAGTAATACAAACAGGATGG - Intronic
1164441853 19:28284985-28285007 ATGAAGGAGAAGAAGGAGGATGG + Intergenic
1164626462 19:29731812-29731834 CTGGAGTGGTAGGTGCAGGAGGG - Intergenic
1164776831 19:30859241-30859263 AAGGAGTAGCAGAAGTTGGATGG + Intergenic
1165031457 19:33000650-33000672 AGGGTGTGGTTGAAGCAGGAAGG - Intronic
1165159889 19:33809952-33809974 ATGGGGCAGGAGAGGCAGGATGG + Intronic
1165189254 19:34048703-34048725 ATGGAGTACAAGAAGCACGAGGG - Intergenic
1166108860 19:40610869-40610891 ATGGAGAAGCAGAATGAGGAGGG + Intronic
1166320824 19:42017896-42017918 ATGGACGAGTGAAAGCAGGAAGG + Intronic
1167406134 19:49309982-49310004 ATGGAGAAGTAGAAGTAGAAGGG - Intronic
1167538980 19:50073471-50073493 CTGGAGGAAGAGAAGCAGGACGG + Intergenic
926056008 2:9774430-9774452 AAGGAGCAGTTGGAGCAGGAAGG + Intergenic
927273461 2:21239463-21239485 ATGGAGAAGAAGAAGAAGGAAGG - Intergenic
927376427 2:22420186-22420208 ATGGAGTAATAGATGAAGTAAGG - Intergenic
928653592 2:33426637-33426659 ATGCAGTATCAGAAGCAGCAAGG + Intergenic
929304173 2:40341058-40341080 ATGGAGTAGTAGAGAGAAGAGGG + Intronic
929316485 2:40485122-40485144 GAGGAGGAGTAGAAGCAGGCAGG + Intronic
930510254 2:52335492-52335514 AAGAAGGAGCAGAAGCAGGAAGG - Intergenic
931134819 2:59386422-59386444 AAGGAGGAGGAGAAGGAGGAGGG - Intergenic
931266192 2:60662316-60662338 AGAGAGCAGTGGAAGCAGGAAGG - Intergenic
931781129 2:65580134-65580156 ATGGAGGGGGAGAAGGAGGATGG - Intergenic
932193425 2:69761570-69761592 GTGGAGTAGCAGAAGCATCACGG - Intronic
932282450 2:70505748-70505770 ATGGATTAGATGAAGCAGAATGG - Intronic
932800927 2:74741759-74741781 ATGAAGAAGTGGAAGCAGCAAGG - Intergenic
933832073 2:86219095-86219117 ATGGAGTTCTGGCAGCAGGAGGG - Intronic
934735311 2:96687083-96687105 AGGGAGGATTAGAAGCAGGGAGG - Intergenic
934884412 2:98012046-98012068 AAGAAGTAGAAGGAGCAGGAAGG + Intergenic
934918074 2:98317018-98317040 ATGGACTAATATAAGCAGGTAGG + Intergenic
935147837 2:100408321-100408343 ATGGAGTGGCGGAAGGAGGAGGG - Intronic
935416066 2:102820745-102820767 ATGAAGTTGGAGAAGCAGGAAGG + Intronic
935735294 2:106101956-106101978 ATGGAGGAGGAGAAGGAGAAGGG - Intronic
936783846 2:116068356-116068378 ATAGAGTAGAAGATGAAGGATGG - Intergenic
937064513 2:119007044-119007066 CTGGAGTAGTGGAAGGAAGAAGG - Intergenic
937345966 2:121125482-121125504 AAGGAGAAGGAGAAGAAGGAAGG + Intergenic
937878821 2:126849933-126849955 AAGGAGGAGGAGGAGCAGGAAGG + Intergenic
938091061 2:128435097-128435119 AGGAAGCAGCAGAAGCAGGAAGG + Intergenic
939861543 2:147426950-147426972 AAAGAGGAGTAGAAACAGGAAGG + Intergenic
940097408 2:149993294-149993316 AGGAAATAGCAGAAGCAGGAAGG - Intergenic
941010843 2:160297817-160297839 TTGGAGGAGGATAAGCAGGAAGG + Intronic
941950827 2:171154677-171154699 ATGAAGTAGTAGAAGCAGTATGG - Intronic
947224057 2:227823041-227823063 ATGGAGAAGTGGAAGATGGAAGG + Intergenic
947295663 2:228627759-228627781 AAGGAGAAGAAGAAGAAGGAGGG - Intergenic
947985892 2:234447136-234447158 TTGGAGTAGAAGAATGAGGATGG + Intergenic
948923808 2:241081391-241081413 AAGGAGGAGGAGAAGGAGGAGGG - Intronic
1169585984 20:7086048-7086070 ATGGAGGAGGAAAAGAAGGAAGG - Intergenic
1169933187 20:10855979-10856001 ATGGACTGGTAGAAAAAGGAAGG + Intergenic
1170129644 20:13005342-13005364 ATGGATAAGTAAAACCAGGAAGG + Intergenic
1170142514 20:13139094-13139116 ATGGAGGAGGAGAAGGAGGGAGG - Intronic
1172347346 20:34213157-34213179 ATGGAGGAGAAGGAGCAAGAAGG - Intronic
1173164475 20:40676995-40677017 TAGGAGTAGGAGAAGTAGGAGGG + Intergenic
1173560863 20:44004411-44004433 AAGGAGAAGGTGAAGCAGGAAGG + Intronic
1173565329 20:44034466-44034488 ATGGAGTACCAGGAGCAGCATGG + Intronic
1174275508 20:49400967-49400989 ATGGATGAATAGAAGAAGGAAGG - Intronic
1174511920 20:51059946-51059968 ATGGAATGAGAGAAGCAGGATGG + Intergenic
1175558859 20:59899578-59899600 ATGTAGTAATAGAAGCAGAAAGG + Intronic
1175839549 20:62018504-62018526 AGAGAGGAGTAGAGGCAGGAGGG - Intronic
1178158377 21:29881697-29881719 ATGGTGCAGTAGAAGAAGAAAGG - Intronic
1178922999 21:36751646-36751668 AGGGAGTGGTGGAAGTAGGAAGG - Exonic
1179185399 21:39081804-39081826 AAGGAGAAGGAGAAGAAGGAGGG + Intergenic
1179238311 21:39566557-39566579 AGGGACAAGAAGAAGCAGGAGGG - Intronic
1179958691 21:44756047-44756069 ATGGAGAAGAAGAGGGAGGAGGG + Intergenic
1181161716 22:20963706-20963728 ATGGAGGGCTGGAAGCAGGAGGG - Intergenic
1181615621 22:24052220-24052242 AGGGCTAAGTAGAAGCAGGAGGG + Intronic
1181615623 22:24052239-24052261 AGGGAGAAGTAGAAGCAAGAGGG + Intronic
1182890198 22:33811808-33811830 ATGGATTAGGAGACACAGGAAGG + Intronic
1184677194 22:46050177-46050199 ATGGGGCAGCAGCAGCAGGAGGG + Exonic
1184978206 22:48078129-48078151 CTGGAAAAGCAGAAGCAGGAAGG - Intergenic
1184986562 22:48140072-48140094 CTGGACTAGAAGAAGCCGGAAGG + Intergenic
950283302 3:11725192-11725214 AAGGAGGAGGAGAAGGAGGAGGG - Intergenic
951011627 3:17688796-17688818 AAGGATTTGTAGAAGCATGAAGG - Intronic
952700094 3:36318536-36318558 ATGGAGGAGGAGGAGGAGGAAGG - Intergenic
952708289 3:36402287-36402309 ATGGAGGGGAAGAAGAAGGAAGG + Intronic
953342722 3:42149310-42149332 AGGGAGTAGGAGGAGCAGAAAGG - Intronic
953528322 3:43713982-43714004 ATGGGGTAGTGGTAGCAGAAAGG + Intronic
955086588 3:55708761-55708783 ATGGAGGAGTGGAAGAAGAAAGG + Intronic
955123390 3:56084690-56084712 TTGGAGACTTAGAAGCAGGAAGG + Intronic
955470462 3:59281636-59281658 ATGGGGGAGAAGAAGGAGGAAGG - Intergenic
955802503 3:62700787-62700809 AGTTAGTAGTAGAAGCAGCATGG + Intronic
955927993 3:64026545-64026567 AGGAAGTGGTAGAAGCAGGAAGG - Intergenic
956049761 3:65235373-65235395 ATGGAGTAGGAGGTGGAGGATGG - Intergenic
956916882 3:73881039-73881061 AAGCAGCAGTAGAAACAGGAAGG + Intergenic
956923257 3:73953463-73953485 ATGGAAAAGTAAAAGCAGAAGGG + Intergenic
957553558 3:81736960-81736982 ATGGAGTAGTAGAAGCAGGAAGG + Intronic
958492821 3:94799211-94799233 TTTGAGAAGTTGAAGCAGGAGGG - Intergenic
958693360 3:97497059-97497081 ACGGAGTGGTAGAAGAAGGGAGG - Intronic
958999406 3:100944947-100944969 ATGTTGTGGAAGAAGCAGGAGGG + Intronic
959243426 3:103830064-103830086 AAGGAGAAGAAGAAGGAGGAAGG - Intergenic
959918131 3:111841328-111841350 ATTGAGTAGGAGTAGGAGGAGGG + Intronic
959989647 3:112616761-112616783 ATGGAGAAGCAGAAGAAGGAGGG - Exonic
960218232 3:115070058-115070080 ATGGTGTAGTTTAAGCAAGAAGG - Intronic
960224747 3:115156641-115156663 AAGAAGTAGAAGAGGCAGGAAGG - Intergenic
960682644 3:120265073-120265095 ATGACTTAGGAGAAGCAGGAGGG + Intronic
961035483 3:123638739-123638761 GAGGAGTAGGAGAGGCAGGAGGG - Intronic
962365038 3:134773163-134773185 ATGGGGGAGGAGAACCAGGAAGG - Intronic
963112112 3:141696485-141696507 ATGGAGTATTAGTAGCTGAAAGG - Intergenic
964793328 3:160473033-160473055 ATTGAGAGGTAGGAGCAGGAAGG - Intronic
965439382 3:168694006-168694028 GAGGAGAAGTAGCAGCAGGAGGG + Intergenic
967231430 3:187341124-187341146 CTGAAGTAGTAGGAGCAGGTGGG + Intergenic
967674413 3:192278860-192278882 ATGGAGAGGGAGGAGCAGGAAGG - Intronic
968449450 4:668436-668458 ATGGGGTAGTGGGAGCAGCATGG - Intronic
968449455 4:668455-668477 ATGGGGTAGTGGGAGCAGCATGG - Intronic
968449460 4:668474-668496 ATGGGGTAGTGGGAGCAGCATGG - Intronic
968449677 4:669273-669295 ATGGGGTAGTGGCAGCAGCATGG - Intronic
968713560 4:2138244-2138266 ATGGGGTTGGAGAAGCAGGTGGG + Intronic
968807800 4:2786838-2786860 ATGGAGAAGTGGAAGGGGGAGGG + Intergenic
969320615 4:6410225-6410247 CTGGAGTAGTGGGAGCAGGCTGG + Intronic
969689714 4:8697855-8697877 CAGGAGCAGGAGAAGCAGGAAGG - Intergenic
970044064 4:11830093-11830115 ATGGAGCAGAAGAAAAAGGAAGG + Intergenic
970652496 4:18193941-18193963 TTGGAGAAATATAAGCAGGATGG + Intergenic
971627848 4:28946267-28946289 ATGGACTATTAGAAGGGGGAGGG + Intergenic
972027283 4:34398777-34398799 ATGGTAGAGTAGAAGGAGGAAGG + Intergenic
972591557 4:40492923-40492945 ATGGAGGAGGGGAAGCAGAAGGG - Intronic
975204987 4:71635226-71635248 ATGCAGTAGTAGCTGCAAGAGGG - Intergenic
975265066 4:72353862-72353884 ATGGAATTCTAGAAGTAGGAGGG - Intronic
976378156 4:84368144-84368166 ATGGGGTGGAAAAAGCAGGATGG + Intergenic
977585776 4:98773912-98773934 AGGGAGGAGGAGAGGCAGGAGGG - Intergenic
978870231 4:113566923-113566945 TTGTAGTAGTTGAAGGAGGAGGG - Intronic
979105742 4:116684580-116684602 ATGAAGGTGTAGATGCAGGAGGG + Intergenic
979585526 4:122410980-122411002 GTGGAGTAGTAGAGAAAGGATGG + Intronic
979717208 4:123854356-123854378 ATGCCGCAGTAGAAACAGGAAGG - Intergenic
980669683 4:135988022-135988044 ATGAAGTAGTAGTAGGAGAAAGG - Intergenic
981421841 4:144559611-144559633 GTGGAGAAGTAAAAGCAAGATGG + Intergenic
984085034 4:175299698-175299720 ATAAAGTAGAAGAAACAGGAAGG + Intergenic
984515266 4:180731008-180731030 ATGGAATAGTACATGCAGGCTGG - Intergenic
986662556 5:10072425-10072447 ATGCAGTAGTAGTAACAGGTGGG - Intergenic
987566371 5:19593530-19593552 AGGGAGAAGGAGAAGAAGGAAGG - Intronic
988919786 5:35929679-35929701 ATGAAGTAAGAGATGCAGGAAGG + Intronic
989626836 5:43437803-43437825 ATGAAGTTAAAGAAGCAGGATGG + Intergenic
989960655 5:50410671-50410693 ATTGAGGAATAGAAGCAGGAAGG + Intronic
990184216 5:53195736-53195758 AGGGAAGAGTAGAAGCAGGAAGG + Intergenic
990767274 5:59198737-59198759 ATACAGAAGTAGAAGAAGGATGG - Intronic
994164290 5:96592675-96592697 TTGGAACAATAGAAGCAGGAAGG - Intronic
996289832 5:121839689-121839711 ATGGAAAAGAAGAAGCAGCATGG + Intergenic
997639780 5:135441690-135441712 CGGGAGTATTAGAAGCAGGCAGG - Intergenic
998103613 5:139454732-139454754 ATGGAGTGGCAGATGCAGGCTGG + Intronic
998342547 5:141431109-141431131 ATGGAGTAGAAGTAGAAGTAAGG + Exonic
1000166740 5:158657163-158657185 AGGCAGAAGTAGAAGCAGTAGGG - Intergenic
1000422294 5:161052617-161052639 AGGAAGTAGTAGAATCAGGATGG - Intergenic
1000662978 5:163959143-163959165 ATGGAGGAAGAGAAGAAGGAAGG - Intergenic
1000747655 5:165055053-165055075 GAGGAGGAGTAGAAGGAGGAAGG - Intergenic
1001082340 5:168676545-168676567 ATGGGCTGGTAAAAGCAGGAAGG + Intronic
1002757377 6:174849-174871 ATGGGGTAGTATATGCAGGTGGG + Intergenic
1003846136 6:10175245-10175267 ATGGAGAAGAAAAGGCAGGAAGG - Intronic
1003872779 6:10415113-10415135 GTGGAGGAGGAGAAGGAGGAGGG + Exonic
1008087806 6:47262741-47262763 ATGGACAAGGAGGAGCAGGAAGG + Intronic
1009425281 6:63506962-63506984 AGGGAGTAGAAGAATGAGGAAGG + Intergenic
1009563352 6:65276766-65276788 ATTGGGTAGTAGAAGAAGCAGGG + Intronic
1011421332 6:87176540-87176562 AGAAAGTAGCAGAAGCAGGAAGG - Intronic
1013075331 6:106765861-106765883 AGGGAATACTAGAAGCAAGAAGG + Intergenic
1014274170 6:119368101-119368123 CAGGACTACTAGAAGCAGGAGGG + Intergenic
1014331487 6:120071209-120071231 ATGGAGTAGGAGAAGCAAGATGG - Intergenic
1015167324 6:130212637-130212659 AGTCAGTAGTAGAACCAGGAAGG + Intronic
1015210663 6:130694865-130694887 ATGGAGAAGCAGCAGCAGGAAGG + Intergenic
1015261370 6:131241280-131241302 ATGGAGAAGGAGAAGGAGGAGGG + Intronic
1015762801 6:136683250-136683272 ATGAAATACTAGAAGCATGAAGG + Intronic
1016209431 6:141510394-141510416 CTGGAGAAGCTGAAGCAGGAGGG - Intergenic
1016304914 6:142673689-142673711 ATTGAGTAGGGGAGGCAGGAGGG + Intergenic
1016402365 6:143694206-143694228 AGGAAGAAGTAGAAGGAGGAAGG + Intronic
1016560667 6:145392419-145392441 AAGGAGCAGTAGAAGGAGAATGG - Intergenic
1016919577 6:149278726-149278748 AAGGAGAAGTAGAGGAAGGAAGG + Intronic
1017055392 6:150431432-150431454 ATGTAGAACCAGAAGCAGGAGGG + Intergenic
1017297236 6:152812085-152812107 AAGGAGGAGGAGAAGAAGGAAGG - Intergenic
1018012675 6:159685966-159685988 ATGGAGGCGTAGAAGAAGGAGGG - Intronic
1018305269 6:162448325-162448347 ATGGGGTAGTAATCGCAGGAGGG - Intronic
1020650234 7:10866022-10866044 GGAGAGTACTAGAAGCAGGAGGG - Intergenic
1020917531 7:14214929-14214951 ATGGAGTGGGAGAAGGAGGGAGG - Intronic
1021075163 7:16294528-16294550 TTGAATTAGTAAAAGCAGGAAGG - Intronic
1023180917 7:37482554-37482576 ATGGAATAATAGATGCAGAAGGG - Intergenic
1025284351 7:57650144-57650166 ACAGAGCAGAAGAAGCAGGAGGG + Intergenic
1025797793 7:64756178-64756200 ATTGGGTAGAAAAAGCAGGAAGG - Intergenic
1028812090 7:95099115-95099137 TTGTAGTAAAAGAAGCAGGAAGG + Intronic
1028820151 7:95200076-95200098 ATGGAACATTAGAAGCTGGAAGG - Intronic
1032252728 7:130271895-130271917 ATGGAGTAGCAGATGCAGGAAGG - Intronic
1033586696 7:142779641-142779663 ATGGAGGAGCAGGAGCAGGAGGG - Intergenic
1039142201 8:34402711-34402733 CTGCAGTAGTAGAAACTGGAAGG - Intergenic
1040847328 8:51857492-51857514 ATGGAGTATCAGAACCACGAAGG - Intronic
1041524933 8:58794821-58794843 CTGGAGAAAGAGAAGCAGGAAGG + Intergenic
1041565843 8:59277831-59277853 ATGGAGTATGGGAAGCAGGCAGG + Intergenic
1041678652 8:60563599-60563621 AGGGAGTAGCTGAAGCAGGGTGG - Intronic
1042942189 8:74118755-74118777 AAGGAGAAGGAGAAGGAGGAGGG - Intergenic
1044257897 8:90087251-90087273 ATGTAGAAGTAGAAGCTGAATGG + Intronic
1044377218 8:91489730-91489752 AAGGTGTAGTTGAAGCAGAATGG + Intergenic
1044552343 8:93526211-93526233 ATGGAAGAGTAGAAAAAGGAGGG - Intergenic
1046182188 8:110665308-110665330 ATGGAGTGGAAGAATCATGAGGG - Intergenic
1046421167 8:113984717-113984739 ATTGAGCAGGAGGAGCAGGAGGG + Intergenic
1047871288 8:129085447-129085469 AAGGGGTAATAGAAACAGGAAGG + Intergenic
1048039210 8:130709173-130709195 ATGGAGAATTAGAATGAGGAGGG + Intergenic
1048044430 8:130759698-130759720 ATGGAGTATAAAAAGCAGGCAGG + Intergenic
1048147303 8:131857978-131858000 ATGGAGAAGGAGAAGAAAGAAGG - Intergenic
1048214783 8:132484131-132484153 ATGGAGGAGGGGAAGCAGGTGGG - Intergenic
1048787603 8:138066961-138066983 TTGGAGAAGCAGAAGCAGAAGGG + Intergenic
1050010425 9:1180316-1180338 AAGGAGAAGAGGAAGCAGGAAGG - Intergenic
1051114850 9:13683035-13683057 ATGGAGTGGTGGAACCAGGCAGG + Intergenic
1051283373 9:15466954-15466976 ATTAAGTAGTAGAAACACGATGG - Intronic
1051524190 9:18024418-18024440 AGGGAGTACTAGAGGAAGGAGGG - Intergenic
1052273668 9:26654254-26654276 GTTGAGTTGTAGAAGCAGCATGG + Intergenic
1056253210 9:84771971-84771993 ATAGAGTAGCAGAAGGAGCAGGG + Intronic
1056280029 9:85032137-85032159 ATAGAATAGTGGAGGCAGGAAGG - Intergenic
1057339816 9:94190062-94190084 ATGGAAAATGAGAAGCAGGAGGG - Intergenic
1057852519 9:98576334-98576356 ATGGAATAGTAAACGGAGGAAGG - Intronic
1059586393 9:115612001-115612023 AGGGAGGAGTTGAAGAAGGAAGG + Intergenic
1059759067 9:117321216-117321238 ATGCAGTAGAAGAATCAGGCAGG + Intronic
1059880831 9:118687104-118687126 ATGGAGTGGCTGAAGCAGGATGG - Intergenic
1060885136 9:127146225-127146247 GTGGACTATTAGAGGCAGGAGGG - Intronic
1061014211 9:127972608-127972630 AGCAAGTAGCAGAAGCAGGATGG + Intronic
1062092580 9:134686221-134686243 AAGGAGAAGGAGAAGGAGGAAGG - Intronic
1062638406 9:137503569-137503591 AAGGAGAAGGAGAAGGAGGAGGG + Intronic
1185603702 X:1355266-1355288 ATGGAGGAAGAGGAGCAGGAGGG + Intronic
1185913793 X:4011651-4011673 ATGGGGAAGGAGGAGCAGGAAGG - Intergenic
1186445042 X:9620135-9620157 ATGGAGAAGTAGAAGCCACACGG - Intronic
1186849780 X:13569376-13569398 GTTGAGAAGTCGAAGCAGGATGG - Intergenic
1188790368 X:34402162-34402184 GTGGACTACTAGAAGCAGGAGGG + Intergenic
1190257897 X:48777589-48777611 ATGAAGGAATAGAAGAAGGAAGG + Intergenic
1192249673 X:69401398-69401420 AAGGAGTAATAAAAGAAGGAAGG - Intergenic
1192681850 X:73260955-73260977 CTGAAGAAGTAGAATCAGGAAGG - Intergenic
1193435320 X:81468276-81468298 ACCAAGGAGTAGAAGCAGGATGG - Intergenic
1193601538 X:83512572-83512594 ATGGAGAGGAAGAAGAAGGATGG - Intergenic
1194190687 X:90833675-90833697 ATGGAGTTCAAGAAACAGGAAGG - Intergenic
1195654754 X:107323938-107323960 ATGGAGCACGAGAGGCAGGAGGG + Intergenic
1196551657 X:117033935-117033957 GGTGAGTAGTAGAAACAGGAAGG - Intergenic
1198029488 X:132741262-132741284 ATGGTGTAGAAGAAACAGCACGG + Intronic
1198516248 X:137410639-137410661 ATGAAGTAGTAGCAGGAGGGAGG - Intergenic
1198767210 X:140091743-140091765 ATGGAGGAGCAGCAGAAGGAGGG + Intergenic
1199387873 X:147243980-147244002 ATGGAGAAAAAGAAGAAGGAAGG - Intergenic
1200537344 Y:4416096-4416118 ATGGAGTTCAAGAAACAGGAAGG - Intergenic
1200757309 Y:7001935-7001957 ATGGAGAAGTAGAAGCCACATGG - Intronic
1201592059 Y:15626378-15626400 ATGGAGCATTCAAAGCAGGAAGG - Intergenic