ID: 957554080

View in Genome Browser
Species Human (GRCh38)
Location 3:81743700-81743722
Sequence AAGACCAGATTTACTTTGTC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 167
Summary {0: 1, 1: 0, 2: 0, 3: 10, 4: 156}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
957554079_957554080 2 Left 957554079 3:81743675-81743697 CCTGATCTCAGTCATTTTATCAA 0: 1
1: 0
2: 1
3: 18
4: 301
Right 957554080 3:81743700-81743722 AAGACCAGATTTACTTTGTCTGG 0: 1
1: 0
2: 0
3: 10
4: 156

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
957554080 Original CRISPR AAGACCAGATTTACTTTGTC TGG Intronic
901107980 1:6772217-6772239 AAGAGCAAATTGACTTTATCTGG + Intergenic
903332460 1:22603016-22603038 AAGACCATTTTTGCATTGTCAGG - Exonic
903610639 1:24609391-24609413 AGGACTCTATTTACTTTGTCAGG - Intergenic
909519884 1:76555509-76555531 ATGACCAGGTTCACTTTGTTTGG - Intronic
912183529 1:107247631-107247653 ATGATCAGCTTTTCTTTGTCGGG + Intronic
913069380 1:115285393-115285415 GAAACCAGATCTACTTTGACAGG + Intergenic
922117673 1:222630285-222630307 AAGACCTCATCTATTTTGTCAGG + Exonic
1063553017 10:7051312-7051334 AAGACTGGATTTAATTAGTCTGG - Intergenic
1063801012 10:9578163-9578185 AAGACCAGTACTACTTTGTTAGG + Intergenic
1068625213 10:59238115-59238137 AAAATCAGATTTACTTTGACAGG + Intronic
1068878094 10:62019059-62019081 AATACCAAATTTACATTGTTAGG + Intronic
1069179619 10:65341879-65341901 AATAGCAAATTTACTTTGTTAGG + Intergenic
1071450762 10:85790026-85790048 CAGCTTAGATTTACTTTGTCTGG + Intronic
1071834073 10:89402248-89402270 AAAAACAGATTTTCTTTGTTAGG - Intronic
1071873222 10:89817345-89817367 AGGAGCAGTTTTTCTTTGTCCGG - Intergenic
1072001254 10:91197865-91197887 GAAACAAGATTTTCTTTGTCTGG + Intronic
1072098376 10:92205203-92205225 TAAACCAGCATTACTTTGTCAGG - Intronic
1072223290 10:93345798-93345820 AGGACCAGATTTTCCTTTTCTGG + Intronic
1073034772 10:100555994-100556016 AAGACATCATTTACATTGTCAGG + Exonic
1080286356 11:30618473-30618495 CAGAACAGATTCACTTTGCCTGG - Intergenic
1081269946 11:41071023-41071045 ATGACCACATTTTCTTTATCTGG - Intronic
1082694208 11:56339686-56339708 AAGCCCAGAGTTTCTTTGTTAGG - Intergenic
1082708404 11:56521572-56521594 AAGAGCAGATTTGTTTTCTCTGG - Intergenic
1084444239 11:69194220-69194242 ATGACCAGAGTTGCTTTGCCAGG + Intergenic
1086425076 11:86674840-86674862 CAGAACAGATTTGCTTTGGCTGG - Intergenic
1086867391 11:91996723-91996745 AATAGCAGATTTCCTTTATCTGG + Intergenic
1087847107 11:102985818-102985840 CAGTCTAGATTTACATTGTCGGG + Intergenic
1087936557 11:104040104-104040126 AAGACCACATTTAATCTTTCTGG + Intronic
1089905330 11:122032323-122032345 AAAACCAGTTTTACTTTTTTTGG - Intergenic
1091359470 11:134964172-134964194 AGGACCAGATTTATTCTCTCAGG - Intergenic
1091676257 12:2492784-2492806 AAGTCCATATTTTCTTTTTCTGG - Intronic
1093779401 12:23117500-23117522 ATTACCATATTTACTTTGTAGGG + Intergenic
1094798770 12:34005410-34005432 AAGTCCAGAGTTTCTTTGTTAGG - Intergenic
1095280754 12:40349978-40350000 TAGACCAGATTTACGTTAACTGG - Intronic
1095444765 12:42272620-42272642 ATGCCCAGCTTTACTGTGTCCGG + Intronic
1096336226 12:50758765-50758787 GTGAACAGATTTACTTTTTCTGG + Intergenic
1097401213 12:59130107-59130129 GATATCAGTTTTACTTTGTCAGG - Intergenic
1100572303 12:95854282-95854304 AATACCAGGTTTCCTTTGTTGGG + Intergenic
1101225847 12:102687613-102687635 TAGAACAGATTTACTAAGTCTGG + Intergenic
1102227628 12:111240236-111240258 AGGCCCAGTTTTGCTTTGTCTGG - Intronic
1103014507 12:117483326-117483348 CAAACAAGATTCACTTTGTCCGG + Intronic
1106096666 13:26651676-26651698 AATCCCATATTTACTTTGTCTGG - Intronic
1106611273 13:31283935-31283957 AAGAAAAGAATTACTTGGTCAGG + Intronic
1109602244 13:64646543-64646565 AATACCAGATTTGATTTTTCTGG + Intergenic
1110411343 13:75206699-75206721 AAGATCAAATTTTCTTTTTCTGG - Intergenic
1111585866 13:90284074-90284096 AAAACAAAATTTACCTTGTCAGG - Intergenic
1113171694 13:107512096-107512118 AAAACCTGGTTTACTTTGGCTGG + Intronic
1114399130 14:22393324-22393346 AGCACCAGGTTTGCTTTGTCGGG - Intergenic
1116762978 14:49037891-49037913 GAGACTTGATTTACTTGGTCTGG - Intergenic
1117991692 14:61440070-61440092 AAGACAAGTTTTGCTTTGGCCGG + Intronic
1118639249 14:67777149-67777171 AAGACCAGTTTTACTTGATCTGG + Intronic
1119332040 14:73802227-73802249 AAGACCAGTTTTCCTTGCTCTGG + Intergenic
1120992200 14:90387168-90387190 TAGACCAGATGGACTTTCTCTGG - Intergenic
1126231288 15:46328536-46328558 AAGACCAGCTGTATTCTGTCTGG - Intergenic
1127180555 15:56411881-56411903 CTGAAAAGATTTACTTTGTCAGG + Intronic
1129062509 15:72871612-72871634 CAGACAAGATTTGATTTGTCAGG + Intergenic
1132794438 16:1712483-1712505 GAGACCAGATATGCTTTGTGAGG - Intronic
1148354087 17:46963693-46963715 AAGAACATATGTTCTTTGTCTGG - Intronic
1151031896 17:70750366-70750388 AAGAGCAGATGCACTTTGTCGGG + Intergenic
1153340895 18:3973704-3973726 TAGCCTAGATTTAGTTTGTCAGG - Intronic
1154495625 18:14957836-14957858 AGGACCAGATTTATTCTCTCAGG + Intergenic
1155399244 18:25419979-25420001 AGGAACATATTTTCTTTGTCGGG - Intergenic
1156545750 18:37962239-37962261 AAGACAACATCTCCTTTGTCAGG + Intergenic
1156633745 18:39000850-39000872 AATGCCAGCTTTATTTTGTCTGG + Intergenic
1160252148 18:77211901-77211923 AAGAACAGAAATACTTTTTCAGG - Intergenic
1167512594 19:49903678-49903700 AAGAGCTGATTTACATTTTCAGG + Intronic
930262750 2:49166396-49166418 CAGCCCTGATTTACTGTGTCAGG + Intergenic
937769775 2:125706847-125706869 AAGACCCTATTTGCTTTCTCTGG - Intergenic
938280486 2:130060506-130060528 AAGAACTGATGTACCTTGTCCGG - Intergenic
939658128 2:144853014-144853036 AAAACCAGATTTACCTTGCTTGG + Intergenic
944082696 2:195806726-195806748 AAGCCCACATTTACCTTGTCTGG + Exonic
945391384 2:209269210-209269232 CAGGCCAGATTTTATTTGTCTGG + Intergenic
949024759 2:241761839-241761861 CAGCTCAGATTTTCTTTGTCTGG + Intronic
1169571390 20:6909992-6910014 GAGACCAAAATTAATTTGTCTGG + Intergenic
1172934512 20:38610085-38610107 AAGACCAGATGTTCTTAATCTGG + Intronic
1177436436 21:21059891-21059913 TAGACCAGAATTTCTCTGTCTGG - Intronic
1182905302 22:33930834-33930856 ATGCCCAGATTTACTCTGTGGGG - Intergenic
1183263794 22:36813454-36813476 TACACCAGTTTTCCTTTGTCTGG + Intronic
1183754074 22:39742725-39742747 AAAACCAGTTTCAATTTGTCTGG + Intergenic
1184549034 22:45194532-45194554 AAGACCATCTTTAATTTTTCTGG - Intronic
951344366 3:21529128-21529150 AAGTCAATATTTACTTTGTATGG + Intronic
952326733 3:32326804-32326826 AAGACCAGACTGACTGTGCCTGG - Intronic
954920983 3:54190681-54190703 AAAAAGAGATTTACTTTCTCTGG - Intronic
955728813 3:61961554-61961576 AAGATCAGATATTCCTTGTCTGG + Intronic
957554080 3:81743700-81743722 AAGACCAGATTTACTTTGTCTGG + Intronic
961839727 3:129698967-129698989 AAGAACAGATTTTCTCAGTCTGG - Intronic
963468075 3:145708570-145708592 AAAATCAGATTTACTGTGTTGGG - Intergenic
965171618 3:165272510-165272532 CAGACCAGATTTAATCTTTCAGG + Intergenic
966332162 3:178826301-178826323 AAGGTCAGATTTAATTGGTCCGG + Intronic
974965687 4:68758378-68758400 AAGTCCAGAGTTTCTTTGTTAGG + Intergenic
975059890 4:69984746-69984768 ATGGCCAGAATTACTTTTTCAGG + Intergenic
975202297 4:71606138-71606160 AAGACAAGATGTATTTTATCAGG - Intergenic
976691043 4:87867484-87867506 AAGGCCAGATTTACTATGTATGG - Intergenic
976858249 4:89629996-89630018 AATGCCAGAATTACTTTGTATGG + Intergenic
976881950 4:89937134-89937156 TAGACCAGATTTACTTATTTTGG + Intronic
979314252 4:119242227-119242249 CAGACAAGGTTTACCTTGTCAGG + Intronic
980409548 4:132398847-132398869 TATACCAGATTTTCTTTATCTGG - Intergenic
981666086 4:147228372-147228394 AAAACCAGAATTACTTTGATAGG - Intergenic
982904605 4:161051949-161051971 AATACCATCTTTACTTGGTCAGG + Intergenic
983720792 4:170849091-170849113 AAGACCTGTGTTACTGTGTCTGG + Intergenic
983788890 4:171769940-171769962 AAGACCGGATTTATTTAGACTGG + Intergenic
989743876 5:44804949-44804971 AAGACAATATTTACTTTGAAAGG + Intergenic
989764832 5:45069816-45069838 AAGACCACATTTTGTTTGTGTGG + Intergenic
996421252 5:123265340-123265362 AAGCCCAGATTTAATTTTCCTGG + Intergenic
997033947 5:130164560-130164582 AAGACCAGATTTATTCTGGTTGG + Intronic
999022978 5:148191108-148191130 AAAACCACATTTACTTTTTGGGG - Intergenic
999512047 5:152262567-152262589 AAAAGCAGTTTTACTTTGTCAGG - Intergenic
1000635841 5:163642895-163642917 AAGAACAATCTTACTTTGTCTGG - Intergenic
1003923676 6:10856745-10856767 AAGAACAGAATTATTTTGTGTGG + Intronic
1005111710 6:22289024-22289046 AAGACAAAATTTACTGTGTAAGG + Intronic
1005346839 6:24898849-24898871 AAAAACATATTTACTTTCTCTGG + Intronic
1005447444 6:25939230-25939252 AAGAGCAGTTTTCATTTGTCTGG - Intergenic
1006685990 6:35834526-35834548 AAGACCAGAGTTATTTTGGTTGG - Exonic
1007530997 6:42542333-42542355 AAGCCCAGATTTTTTTTTTCAGG + Intergenic
1008000407 6:46353973-46353995 AAGCCCTGGTTTACTTTCTCGGG + Intronic
1009025572 6:57996352-57996374 AAGACAAAATTTACGATGTCTGG - Intergenic
1012787724 6:103654094-103654116 AAGAAGAGATTTACTATGTGTGG + Intergenic
1014324756 6:119979319-119979341 AAGACCAGTTTTCCTTTGGGAGG - Intergenic
1014581494 6:123142652-123142674 ATTACCAGAATTACTTTTTCTGG - Intergenic
1015125347 6:129748169-129748191 AAGATCAGGTTTACTTTGGAGGG + Intergenic
1018089666 6:160334654-160334676 AGGACCACCTTTCCTTTGTCTGG + Intergenic
1018394307 6:163365790-163365812 AAGACCAGATGTCCTGTGTGTGG + Intergenic
1018973033 6:168541772-168541794 AAGATCAGATTAACTTTGTGTGG + Intronic
1023534888 7:41197791-41197813 AATCCTAGATTTACTTTGTTTGG + Intergenic
1028340539 7:89714374-89714396 CAGACCAAATGTACTTTGCCAGG + Intergenic
1028669311 7:93383046-93383068 AAGACCAAATTTCCTTTCCCAGG + Intergenic
1029924162 7:104298057-104298079 AAGACCAAATTTATTTTACCTGG + Intergenic
1030564298 7:111133632-111133654 AAGACCAGAATTAATTTATAAGG + Intronic
1030676479 7:112390992-112391014 AAGACAAGAATAACTGTGTCTGG + Intergenic
1031799285 7:126222846-126222868 ATTACCAGAATTACTTTTTCTGG + Intergenic
1034156141 7:148957577-148957599 TACACCAGATTTTCTTTATCTGG + Intergenic
1034711979 7:153200857-153200879 AAGACCAGCTTTAGTTGGTCAGG - Intergenic
1035690982 8:1559681-1559703 AAGAAGAGATTCACTTTGGCAGG - Intronic
1037442701 8:18932937-18932959 ATGATCACATTTAGTTTGTCTGG - Intronic
1040647149 8:49412530-49412552 AAGAACAGAGTTACATTGTAGGG - Intergenic
1040879557 8:52190576-52190598 AAGAACACATTTACCATGTCAGG - Intronic
1041189556 8:55339936-55339958 AAGACTTGATTTTCTTTTTCAGG - Intronic
1041534016 8:58905362-58905384 AAGATCCTATTTACTTTGACAGG + Intronic
1042916875 8:73884123-73884145 AAGACCACTTTTCCTTTGTGTGG + Intergenic
1043334885 8:79163154-79163176 AAGAGCAGATGTACTTGGGCAGG - Intergenic
1043710300 8:83408107-83408129 AAAACCTGATTTGCTTTGTAGGG + Intergenic
1044193899 8:89352285-89352307 AACACCAGAGTTTCTATGTCTGG - Intergenic
1044773318 8:95660779-95660801 AAGAACAGATTTACATGGCCTGG + Intergenic
1045420462 8:102009653-102009675 AAGATCAGATTTGCTGTTTCAGG + Intronic
1045446214 8:102267242-102267264 AAGACCACATTCATTTTGTCAGG - Intronic
1049025459 8:139985314-139985336 ACGACCAGATTTATGTTCTCTGG + Intronic
1050700040 9:8328665-8328687 AACACCAAATTTACTTTGATTGG - Intronic
1050833126 9:10039287-10039309 AAGACCATAATTTATTTGTCAGG + Intronic
1050872881 9:10596724-10596746 GAGAAGAAATTTACTTTGTCAGG + Intronic
1053398357 9:37796129-37796151 AAAACCACATCTACCTTGTCAGG - Intronic
1055095529 9:72409627-72409649 AAGAGCAGAGTTATTTTGTTAGG + Intergenic
1059636787 9:116179342-116179364 AGGACCAGATTTCCTTTTGCAGG - Intronic
1060878145 9:127098412-127098434 AAGACCACATTTACATTCTTGGG + Intronic
1186133019 X:6490108-6490130 AAGTCCAGCTTTACTTTCTGAGG + Intergenic
1186307129 X:8273913-8273935 AAAATAATATTTACTTTGTCTGG - Intergenic
1186841213 X:13486420-13486442 AAGACCAGATTTATGTTTTTTGG - Intergenic
1189451244 X:41132833-41132855 AACACCAGATTTCCTTTTGCTGG - Intronic
1191627533 X:63284365-63284387 GAGACCATATTTATTTTGTTAGG - Intergenic
1192034622 X:67548434-67548456 AAGAACAAATTTACTTGGTAGGG + Intronic
1193453818 X:81703885-81703907 TAGAGCAAATTTACTTTGGCAGG + Intergenic
1195311094 X:103632580-103632602 AAAAGCAGATTTACTGGGTCTGG - Intergenic
1195496669 X:105543283-105543305 ATGACCATATTTATTTTCTCTGG - Intronic
1196306922 X:114113942-114113964 GAGAGTAGATTTTCTTTGTCAGG + Intergenic
1197488630 X:127087666-127087688 AAGATCAGAATTAAGTTGTCAGG - Intergenic
1197945323 X:131832266-131832288 AAGCCAAAATTTACATTGTCAGG + Intergenic
1198230225 X:134682296-134682318 TAAACCGGATTTAGTTTGTCTGG + Intronic
1200362135 X:155618513-155618535 AATACCAGTTTTAATTTTTCTGG + Intronic