ID: 957555567

View in Genome Browser
Species Human (GRCh38)
Location 3:81761464-81761486
Sequence GAGCGCCGCCTCGTAGTCCT CGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 64
Summary {0: 1, 1: 0, 2: 0, 3: 2, 4: 61}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
957555562_957555567 8 Left 957555562 3:81761433-81761455 CCAGTTCGGGCACGTCAGCCAGG 0: 1
1: 0
2: 0
3: 5
4: 51
Right 957555567 3:81761464-81761486 GAGCGCCGCCTCGTAGTCCTCGG 0: 1
1: 0
2: 0
3: 2
4: 61
957555566_957555567 -10 Left 957555566 3:81761451-81761473 CCAGGGCGGCATTGAGCGCCGCC 0: 1
1: 0
2: 0
3: 5
4: 68
Right 957555567 3:81761464-81761486 GAGCGCCGCCTCGTAGTCCTCGG 0: 1
1: 0
2: 0
3: 2
4: 61
957555561_957555567 20 Left 957555561 3:81761421-81761443 CCAGGAGTCTGGCCAGTTCGGGC 0: 1
1: 0
2: 0
3: 9
4: 96
Right 957555567 3:81761464-81761486 GAGCGCCGCCTCGTAGTCCTCGG 0: 1
1: 0
2: 0
3: 2
4: 61

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
957555567 Original CRISPR GAGCGCCGCCTCGTAGTCCT CGG Exonic
901577135 1:10210340-10210362 GAGCGCCCCCTGGTGGCCCTCGG - Intergenic
904658681 1:32068644-32068666 GAGTGCAGCCTCAAAGTCCTGGG + Intergenic
905569324 1:38991409-38991431 CAGCGCCGCCTCGAACTCCATGG - Exonic
911205971 1:95091689-95091711 GAGCGCCGCCTCTTGCTCCACGG + Intergenic
913009540 1:114669861-114669883 TGGCGCCGCGGCGTAGTCCTCGG - Intronic
913987143 1:143575377-143575399 GAGCGCCGCCTCCTGCTCCATGG + Intergenic
1068460410 10:57321798-57321820 GAGCGCCGCCTCTTGCTCCACGG + Intergenic
1068650084 10:59513016-59513038 GAGTGCCGCCTCTTAGCCCTGGG + Intergenic
1082162385 11:48900183-48900205 GCGCGCCGCCTGGTGGTCCCCGG + Intergenic
1092545809 12:9450446-9450468 GAGCGCCGCCCCCTAATCCGCGG - Intergenic
1094507146 12:31071627-31071649 GAGCGCCGCCCCCTAATCCGCGG + Intergenic
1102050039 12:109855658-109855680 GAGGGCCATCTCGTAGGCCTTGG + Exonic
1108856493 13:54799759-54799781 GAGCGCCGCCCCCTACTCCATGG - Intergenic
1117297613 14:54393762-54393784 GAGCGCCGCCTCCTGCTCCAGGG + Intergenic
1122323031 14:100866885-100866907 GAGCCCCGCCTCCTGGTCCCAGG - Intergenic
1122801597 14:104233035-104233057 GAGCCCCTCCTCCTACTCCTGGG - Intergenic
1123144604 14:106116559-106116581 GGGCGCCCCCTGGTGGTCCTGGG + Intergenic
1123156810 14:106234986-106235008 GGGCGCCCCCTGGTGGTCCTGGG + Intergenic
1123207581 14:106728087-106728109 GGGCGCCCCCTGGTGGTCCTGGG + Intergenic
1124380314 15:29159960-29159982 GAGCGCCGCCTCCTGCTCCATGG - Intronic
1131086005 15:89576005-89576027 GAGCGCGGCCTCGGCCTCCTTGG - Exonic
1132786023 16:1657355-1657377 GTGAGCCGCCTCGTGTTCCTGGG + Intronic
1132856727 16:2048303-2048325 GACTGCCGCCGCGAAGTCCTGGG - Intronic
1136872116 16:33816784-33816806 GAGCGCCCCCTAATGGTCCTGGG - Intergenic
1139433746 16:66924940-66924962 GAGCGAGTCCTCGGAGTCCTCGG + Exonic
1139775728 16:69316051-69316073 CAGCGCCTCCTCGTAGTTCTTGG - Exonic
1141824027 16:86466723-86466745 GAGGGCAGTCTCGTCGTCCTGGG - Intergenic
1203100056 16_KI270728v1_random:1299284-1299306 GAGCGCCCCCTAATGGTCCTGGG + Intergenic
1142596419 17:1031970-1031992 GAGCGCCGCCTCCCAGGCCCAGG + Intronic
1147161240 17:38570641-38570663 GAGGCCCACCTCGTGGTCCTGGG + Intronic
1148183078 17:45620609-45620631 CAGCGCCCACTCGTAGGCCTGGG + Intergenic
1148265773 17:46225082-46225104 CAGCGCCCACTCGTAGGCCTGGG - Intronic
1157272740 18:46289153-46289175 CAGTGCCGCCTTGTACTCCTGGG + Intergenic
1158806625 18:60981216-60981238 GAGCCCCGTCTCGTAGAACTTGG - Intergenic
1165408222 19:35643344-35643366 GAGCGGCGCCTCGCAGACCCTGG + Exonic
1166944520 19:46388668-46388690 GTGAGCCACCTCGTAGCCCTCGG - Exonic
927777841 2:25915784-25915806 GAGCGCCGCCTCCTGCTCCACGG + Intergenic
1170806801 20:19639668-19639690 GAGCGCCGCCCCCTGCTCCTCGG - Intronic
1171033910 20:21701628-21701650 GAGCGCCGCCTCGGAGCGCAAGG - Intergenic
1173601643 20:44299457-44299479 GAGCGCCGCCCCCTACTCCACGG + Intergenic
1182350246 22:29695365-29695387 GAGCGCCGCCTCGGGGTGCCTGG - Exonic
1182857935 22:33534667-33534689 CAGCCCCGCCTCGGAGGCCTGGG - Intronic
1184584305 22:45437051-45437073 GAGCGCCGCCCCGTGCTCCACGG + Intergenic
957555567 3:81761464-81761486 GAGCGCCGCCTCGTAGTCCTCGG + Exonic
962071205 3:132035132-132035154 GAGCGCCGCCGCCAAGGCCTGGG - Exonic
964525141 3:157609500-157609522 GAGAGTTGCCTCTTAGTCCTTGG - Intronic
968659725 4:1793988-1794010 CGGCGCCTCCTCGGAGTCCTTGG + Exonic
980581680 4:134762363-134762385 GAAGGCAACCTCGTAGTCCTAGG - Intergenic
993664836 5:90683284-90683306 GACTGCAGCCTCGAAGTCCTGGG + Intronic
999023660 5:148199835-148199857 GAACCCCTCCTCTTAGTCCTAGG + Intergenic
1002789330 6:426237-426259 GAGCGCCGCCCCGTGCTCCACGG - Intergenic
1004499627 6:16198137-16198159 GAGCGCCGCCTCCTGCTCCACGG - Intergenic
1005561478 6:27045556-27045578 GAGCGCCGCCCCCTACTCCACGG + Intergenic
1005602552 6:27442543-27442565 GAGTGCAGCCTCGAACTCCTGGG - Intergenic
1005895253 6:30172204-30172226 CTGCCCCGCCTCGTAGTCCAGGG - Exonic
1007581078 6:42960589-42960611 GGGCGCTGCCTCGCAATCCTGGG - Intergenic
1017839445 6:158209787-158209809 GAGCGCCGCCTCCTGCTCCAGGG - Intergenic
1037397814 8:18461200-18461222 TAGCGCAGCCTTGAAGTCCTGGG - Intergenic
1039725775 8:40214749-40214771 GAGCACCGCCTTGCAGTGCTGGG + Intergenic
1046208840 8:111040874-111040896 GAGCGCCGCCCCCTGCTCCTCGG - Intergenic
1050249990 9:3734090-3734112 GAGCGCCGCCCCCTACTCCACGG + Intergenic
1188005431 X:25013305-25013327 CAGCTCCTCCTCGTCGTCCTCGG + Exonic
1189415184 X:40806453-40806475 GAGTGCAGCCTCCTAGGCCTTGG + Intergenic
1202109887 Y:21407524-21407546 GAGCGCCGCCCCCTACTCCACGG + Intergenic