ID: 957560380

View in Genome Browser
Species Human (GRCh38)
Location 3:81813635-81813657
Sequence TCAATTAATTTTTGTCCCAA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
957560380_957560381 3 Left 957560380 3:81813635-81813657 CCTTTGGGACAAAAATTAATTGA No data
Right 957560381 3:81813661-81813683 CAAAATGCAAAGATCCAGCTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
957560380 Original CRISPR TCAATTAATTTTTGTCCCAA AGG (reversed) Intergenic
No off target data available for this crispr