ID: 957560381

View in Genome Browser
Species Human (GRCh38)
Location 3:81813661-81813683
Sequence CAAAATGCAAAGATCCAGCT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
957560377_957560381 21 Left 957560377 3:81813617-81813639 CCTTGAAAAACAATGTTTCCTTT No data
Right 957560381 3:81813661-81813683 CAAAATGCAAAGATCCAGCTTGG No data
957560380_957560381 3 Left 957560380 3:81813635-81813657 CCTTTGGGACAAAAATTAATTGA No data
Right 957560381 3:81813661-81813683 CAAAATGCAAAGATCCAGCTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
957560381 Original CRISPR CAAAATGCAAAGATCCAGCT TGG Intergenic
No off target data available for this crispr