ID: 957577685

View in Genome Browser
Species Human (GRCh38)
Location 3:82030787-82030809
Sequence CTGTAGAGACAGTAGCAGCT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
957577683_957577685 -4 Left 957577683 3:82030768-82030790 CCTCACTTTCAGACTCTTACTGT No data
Right 957577685 3:82030787-82030809 CTGTAGAGACAGTAGCAGCTGGG No data
957577681_957577685 21 Left 957577681 3:82030743-82030765 CCCATTACGATTTTTCAGTGATG No data
Right 957577685 3:82030787-82030809 CTGTAGAGACAGTAGCAGCTGGG No data
957577682_957577685 20 Left 957577682 3:82030744-82030766 CCATTACGATTTTTCAGTGATGC No data
Right 957577685 3:82030787-82030809 CTGTAGAGACAGTAGCAGCTGGG No data
957577679_957577685 27 Left 957577679 3:82030737-82030759 CCTTTCCCCATTACGATTTTTCA No data
Right 957577685 3:82030787-82030809 CTGTAGAGACAGTAGCAGCTGGG No data
957577680_957577685 22 Left 957577680 3:82030742-82030764 CCCCATTACGATTTTTCAGTGAT No data
Right 957577685 3:82030787-82030809 CTGTAGAGACAGTAGCAGCTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
957577685 Original CRISPR CTGTAGAGACAGTAGCAGCT GGG Intergenic
No off target data available for this crispr