ID: 957577844

View in Genome Browser
Species Human (GRCh38)
Location 3:82032250-82032272
Sequence TACTCCCTCAAGTCTATGGG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
957577836_957577844 22 Left 957577836 3:82032205-82032227 CCCCAGCTTTTGGGTCACTGGGA No data
Right 957577844 3:82032250-82032272 TACTCCCTCAAGTCTATGGGTGG No data
957577839_957577844 -2 Left 957577839 3:82032229-82032251 CCTCTAACTGTTCCCTCTCTTTA No data
Right 957577844 3:82032250-82032272 TACTCCCTCAAGTCTATGGGTGG No data
957577837_957577844 21 Left 957577837 3:82032206-82032228 CCCAGCTTTTGGGTCACTGGGAT No data
Right 957577844 3:82032250-82032272 TACTCCCTCAAGTCTATGGGTGG No data
957577838_957577844 20 Left 957577838 3:82032207-82032229 CCAGCTTTTGGGTCACTGGGATC No data
Right 957577844 3:82032250-82032272 TACTCCCTCAAGTCTATGGGTGG No data
957577833_957577844 29 Left 957577833 3:82032198-82032220 CCTTTCACCCCAGCTTTTGGGTC No data
Right 957577844 3:82032250-82032272 TACTCCCTCAAGTCTATGGGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
957577844 Original CRISPR TACTCCCTCAAGTCTATGGG TGG Intergenic
No off target data available for this crispr