ID: 957578243

View in Genome Browser
Species Human (GRCh38)
Location 3:82036324-82036346
Sequence CAGGCCCACCTCCAATATTG GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
957578234_957578243 -10 Left 957578234 3:82036311-82036333 CCTTCCTTCCCCCCAGGCCCACC No data
Right 957578243 3:82036324-82036346 CAGGCCCACCTCCAATATTGGGG No data
957578230_957578243 25 Left 957578230 3:82036276-82036298 CCATTTATGAGAAATCTGCTGCT No data
Right 957578243 3:82036324-82036346 CAGGCCCACCTCCAATATTGGGG No data
957578232_957578243 -3 Left 957578232 3:82036304-82036326 CCAATCACCTTCCTTCCCCCCAG No data
Right 957578243 3:82036324-82036346 CAGGCCCACCTCCAATATTGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
957578243 Original CRISPR CAGGCCCACCTCCAATATTG GGG Intergenic
No off target data available for this crispr