ID: 957582680

View in Genome Browser
Species Human (GRCh38)
Location 3:82094795-82094817
Sequence TCTTATTTAAAATCACCTTA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
957582679_957582680 -5 Left 957582679 3:82094777-82094799 CCTACTTTAGTGGTCATGTCTTA No data
Right 957582680 3:82094795-82094817 TCTTATTTAAAATCACCTTATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
957582680 Original CRISPR TCTTATTTAAAATCACCTTA TGG Intergenic
No off target data available for this crispr